Rosa26 tdtomato mice

We purchased the BAC clone RP23-65I23 from Children's Hospital Oakland Research Institute. This clone contains the MrgprB2 locus, ~60 kb of 5’ genomic sequence and over 100 kb of 3’ genomic sequence. Recombineering in bacteria was used to introduce eGFP-Cre and a polyA signal immediately after the MrgprB2 start codon^{1 (link)}. The BAC was linearized with NotI (New England Biolabs) and injected into pronuclei from single cell fertilized C57Bl/6 eggs. Eggs were implanted into pseudopregnant females. Three BAC mouse lines were established. Though mice were already in a C57Bl/6 background, they were crossed for at least four generations to WT and tdTomato reporter mice in the C57Bl/6 background before use in experiments. BAC mice were mated to ROSA26^Tdtomato mice purchased from Jackson Labs for imaging studies. Experiments for Figure 1 used mice homozygous for ROSA26^Tdtomato because the tdTomato signal often was heterogeneous and weak in heterozygous mice. Genotyping reactions for BAC mice were run at 61°C annealing, and primers were: forward, tatatcatggccgacaagca; reverse, cagaccgcgcgcctgaaga. Both primers are in the eGFP-Cre reading frame but the entire gene and correct placement in the MrgprB2 locus was verified by previous sequencing.

Our initial studies using rAAV-retro were done using two lines of transgenic mice that we developed in our lab (Gallent and Steward, 2018 (link)). One line was created by crossing Rosa26^tdTomato mice obtained from the Jackson Laboratory (JAX: 007905) with PTEN^f/f mice from our breeding colony to create a new transgenic strain that was homozygous at both loci (Rosa^tdTomato/PTEN^f/f)). Rosa^tdTomato/PTEN^f/f mice have a lox-P flanked STOP cassette in the ROSA locus and lox-P flanked exon 5 of PTEN so AAV-mediated expression of Cre recombinase deletes PTEN and induces robust expression of tdTomato (tdT) in the same neurons. In creating this new transgenic strain, we also selected for mice that were homozygous at the tdT locus as controls. Because the resulting Rosa^tdTomato mice were derived from the crossing, they have a different genetic background from the original, Rosa^tdTomato mice obtained from JAX Labs (genetic background B6;129S6). After achieving homozygosity, the two lines were propagated in our breeding colony. Details on animal use (genotypes, ages at the time of injection, injection location, survival time, and whether mice were used in previous published studies) are in Table 1. Adult female and male mice were between 8 and 12 weeks of age (20–30 g) at the beginning of the experiment.