Using the EZ DNA MethylationTM Kit (ZYMO Research), 200–300 ng of genomic DNA was bisulfite treated according to the manufacturer’s protocol and eluted in 30 μl. Pyrosequencing probes were designed with the Pyromark Design 2.0 software package (QIAGEN). Primers for PCR amplification and sequencing as well as the sequence covered by each assay are indicated in Additional file 10 : Table S3; 2 μl of converted DNA were used as input for PCR amplification using the AmpliTaq Gold DNA Polymerase (Applied Biosystems, N8080247), with one of two primers biotinylated. The temperature profile of the cycles was DNA polymerase activation at 95 °C for 15 min, denaturation at 95 °C for 30 s, annealing at 61 °C for 30 s, and extension at 72 °C for 1 min for the first cycle. For the next 19 cycles, the annealing temperature was decreased by 0.5 °C per cycle. Then, 36 cycles of amplification were performed at 53 °C, the final annealing temperature. The program was finished by a final elongation step at 72 °C for 10 min. Biotinylated PCR product were then purified and immobilized onto streptavidin-coated Sepharose beads (GE Healthcare). Pyrosequencing was performed on the PyroMark Q96 MD (QIAGEN) following the manufacturer’s instructions. Pyro QCpG 1.0.9 (QIAGEN) was used to quantify DNA methylation at single CpGs.
Streptavidin coated sepharose beads
Manufactured by GE Healthcare
Sourced in United States, France, United Kingdom
Streptavidin-coated Sepharose beads are a type of affinity chromatography resin. They are composed of agarose beads with streptavidin covalently attached to the surface. Streptavidin has a high affinity for biotin, allowing the beads to be used for the purification or isolation of biotinylated molecules.
Automatically generated - may contain errors
Lab products found in correlation
Epitect bisulfite kit, by Qiagen (6 mentions)
Pyromark gold q96 reagent, by Qiagen (4 mentions)
Pyromark q96, by Qiagen (3 mentions)
Ez dna methylation kit, by Zymo Research (2 mentions)
Binding buffer, by Qiagen (2 mentions)
Pyromark vacuum prep tool, by Qiagen (2 mentions)
Pyromark q96 mgmt kit, by Qiagen (2 mentions)
Psqtm96 ma system, by Biotage (2 mentions)
Pyromark pcr kit, by Qiagen (2 mentions)
Pyromark assay design software 2, by Qiagen (2 mentions)
Pyromark q96 id, by Qiagen (2 mentions)
Qiaamp dna blood mini kit, by Qiagen (2 mentions)
Veriti thermal cycler, by Thermo Fisher Scientific (2 mentions)
Epitect pcr control dna set, by Qiagen (2 mentions)
Pyromark assay design version 2, by Qiagen (2 mentions)
Pyromark q96 id system, by Qiagen (2 mentions)
Pyromark q24 system, by Qiagen (2 mentions)
Pyromark assay design 2, by Qiagen (2 mentions)
Pyro q cpg 1, by Qiagen (1 mentions)
Pyromark q96 md, by Qiagen (1 mentions)
23 protocols using streptavidin coated sepharose beads
1
Quantifying DNA Methylation via Pyrosequencing
2
BRAF and KRAS Mutation Detection via COLD-PCR and Pyrosequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mutation tests for BRAF c.1799T>A (p.V600E) and KRAS c.34G>A (p.G12S) were performed using target-specific COLD-PCR [15 (link)] followed by pyrosequencing on a PyroMark Q24 instrument (Qiagen). Briefly, PCR reactions were conducted in a total volume of 25 μL containing 5 μL genomic DNA template, 200 nM of each forward and reverse primers, and 12.5 μL 2x HotStarTaq Master Mix (Qiagen) under the conditions described previously[16 (link), 17 (link)]. For the pyrosequencing reactions, 10 μL of PCR product was immobilized on streptavidin-coated Sepharose beads (GE Healthcare) and processed according to the manufacturer’s instructions.
3
Pyrosequencing Assays for DMR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pyrosequencing assays for DMRs at maternally imprinted genes were verified previously [11 (link)]. The H19 assay was designed according to previously identified DMR [52 (link)] and verified in Additional file 2 : Figure S1. Biotin labeled bisulfite PCR products, verified by agarose gel electrophoresis, were made up to 80 μl reaction volumes containing 2 μl streptavidin-coated Sepharose beads (GE Healthcare), 20 μl nuclease free H20 and 40 ul binding buffer (Qiagen). Mixtures were agitated, to enable binding of biotin labeled strands to beads, by shaking at room temperature for 5 min. Template-bead complexes were immobilized to individual prongs on a Pyromark Q24 vacuum manifold (Qiagen) and subjected to a 10 sec ethanol wash (70% ethanol, Sigma); 15 sec denaturation step (PyroMark denaturation solution) and final 20 sec wash step in 1 X PyroMark wash buffer. The vacuum manifold was turned off and the bound template-bead complexes released into 25 μl primer mixes containing 0.3 μM sequencing primer and PyroMark annealing buffer. Internal bisulfite controls were included in each pyrosequencing assay performed. Only sequences that passed the internal control (>95% bisulfite conversion) were included in the analysis.
4
Validating HCRTR2 Polymorphism Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the HCRTR2 polymorphism rs2653342, randomly selected samples were additionally genotyped by pyrosequencing to confirm the TaqMan® assay results, where the distinction between the 3 genotype clusters was consistently poor. Primers (forward: 5′‐CTCGCTGTCATCTTT GTATCCC‐3′; reverse: 5′‐TCGGAGTAACTGGGCAATAGA‐3′) for the preceding PCR and the pyrosequencing primer (5′‐CCTATAAATAGCAC‐3′) were designed using the web‐based softwares Primer332 and mfold.33 Primer sequences were screened on the NCBI webpage (http://blast.ncbi.nlm.nih.gov/Blast.cgi ) to confirm specificity. The PCR was carried out using a non‐biotinylated forward and a biotinylated reverse primer as well as Taq polymerase (Thermo Scientific, Ulm, Germany) to amplify fragments. The biotinylated PCR products were immobilized onto streptavidin‐coated sepharose beads (GE Healthcare, Uppsala, Sweden) using a PyroMark® vacuum prep tool (QIAGEN), denatured and purified in 70% ethanol, 0.2 M NaOH, and washing buffer according to manufacturer’s instructions, and finally annealed to the sequencing primer for 2 minutes at 80ºC. The SNP was analyzed using a PyroMark® Reagent Kit and Q96 ID system (QIAGEN). Samples rerun with pyrosequencing corresponded 100% with the TaqMan® assay results for the 3 different genotypes, and the original TaqMan® results were therefore considered reliable.
5
Pyrosequencing-based DNA Methylation Analysis
6
Pyrosequencing of Bisulfite-Treated DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For pyrosequencing, 500 ng of gDNA was subjected to bisulfite conversion using the EpiTect bisulfite kit (Qiagen). PCR reactions were performed on 12.5 ng of bisulfite-treated DNA in a final volume of 25 µL using the Pyromark PCR kit (Qiagen) with one of the primers being biotinylated for later capture. The primers were designed using the PyroMark assay design software 2.0 (Qiagen) (Supplemental Table S10 ). The initial denaturation/activation step was performed for 15 min at 95°C, followed by 50 cycles of 30 sec at 94°C, 30 sec at 54°C, 45 sec at 72°C, and a final extension step for 10 min at 72°C. The quality and the size of the PCR products were evaluated by running 5 µL of each PCR product on 1.5% (w/v) agarose gel in a 0.5× TBE buffer. The biotinylated PCR products were immobilized on streptavidin-coated Sepharose beads (GE Healthcare). DNA strands were separated using the PyroMark Q24 vacuum workstation; the biotinylated single strands were annealed with 0.375 µM sequencing primer (Supplemental Table S10 ) and used as a template for pyrosequencing. Pyrosequencing was performed using PyroMark Q24 advanced (Qiagen) according to the manufacturer's instructions, and data about methylation at each CpG were extracted and analyzed using the PyroMark Q24 advanced 3.0.0 software (Qiagen).
7
Quantification of PRAC DNA Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted by standard methods using the Wizard Genomic DNA Purification System (Promega). Bisulfite conversion of genomic DNA was carried out using the EZ DNA Methylation Kit (Zymo Research). The DNA methylation status of PRAC was assessed by PSQ using PyroMark Q96 ID (Qiagen, Valencia, CA). The primer sequences and amplification conditions are described in Table 2 . PCR reactions were conducted using 20 ng of bisulfite-converted genomic DNA. A biotin-labeled primer was used to purify the final PCR product using streptavidin-coated Sepharose beads (GE Healthcare, Buckinghamshire, UK). The PCR product was bound to Sepharose beads, purified, washed, denatured using a 0.2 mol/L NaOH solution, and washed again. Subsequently, 0.3 μmol/L PSQ sequencing primer was annealed to the purified single-stranded PCR product and PSQ was performed on a PyroMark Q96 ID (Qiagen, Valencia, CA). Target CpG sites were evaluated using the instrument software (PSQ96MA 2.1, Qiagen, Valencia, CA), which converts programs to numerical values for peak heights and calculates the proportion of methylation at each base as a C/T ratio. Data analysis was performed using PyroMark Q96 ID Software v.1.0 software (Qiagen, Valencia, CA).
8
Bisulfite-Based DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted using QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) and then converted by Sodium Bisulfite using EpiTect Bisulfite Kit (Qiagen). PCR amplification was performed with GABPB1 promoter-specific primers. The PCR product was purified by binding to streptavidin-coated sepharose beads (GE Healthcare, Chicago, IL, USA), denatured, and washed. The sequencing primer was then annealed to the purified PCR fragment followed by pyrosequencing in a PyroMark Q96 (Qiagen). The primer sequences used are listed in Table S1 .
9
Quantifying DNA Methylation Levels in PLD3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from frozen hippocampal tissue by phenol-chloroform method [22 (link)]. Next, 500 ng of genomic DNA was bisulfite converted using the EpiTect Bisulfite Kit (Qiagen, Redwood City, CA, USA) according to the manufacturer’s protocol. Primers to amplify and sequence two promoter regions of PLD3 were designed with PyroMark Assay Design version 2.0.1.15 (Qiagen) (Additional file 1 : Table S2), and PCR reactions were carried out on a VeritiTM Thermal Cycler (Applied Biosystems, Foster City, CA, USA). Next, 20 μl of biotinylated PCR product was immobilized using streptavidin-coated sepharose beads (GE Healthcare Life Sciences, Piscataway, NJ, USA) and 0.3 μM sequencing primer was annealed to purified DNA strands. Pyrosequencing was performed using the PyroMark Gold Q96 reagents (Qiagen) on a PyroMark™ Q96 ID System (Qiagen). For each particular cytosine-phosphate-guanine dinucleotide (CpG), methylation levels were expressed as percentage of methylated cytosines over the sum of total cytosines. Unmethylated and methylated DNA samples (EpiTect PCR Control DNA Set, Qiagen) were used as controls for the pyrosequencing reaction.
10
Pyrosequencing-based DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As a technical validation we used pyrosequencing to carry out replication testing of the relationship between DNA methylation and BMI at 4 loci, using samples of whole blood from 990 Europeans and 1,720 Indian Asians participating in the LOLIPOP study. Pyrosequencing was carried out using biotinylated primers to amplify bisulfite-treated DNA (Supplementary Information Table 26 ). The biotinylated PCR products were then immobilized on streptavidin-coated Sepharose beads (GE Healthcare, Orsay, France). Pyrosequencing was performed with the PyroMark Q96 MGMT kit (Qiagen, Courtaboeuf, France) on a PSQTM96 MA system (Biotage, Uppsala, Sweden).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!