Activity was determined by coupling the KDPG formation to the oxidation of NADH via KD(P)G aldolase (KD(P)GA) from Sulfolobus acidocaldarius (Saci_0225) and L -lactate dehydrogenase (rabbit muscle, Sigma-Aldrich). The KD(P)GA was obtained by PCR amplification of the encoding gene (saci_0225) from genomic DNA of S. acidocaldarius DSM639 using the primers: fd_NdeI: 5′-AAACATATG ATGGAAATAATTTCACCTATCATTACA, rv_ BamHI: 5′-AAAGGATCC TTAATGTACCAGTTCTTGAATCTT TCT. The restricted PCR product was cloned into pET11c (Novagen). For protein expression and purification conditions refer to Wolterink-van Loo et al. (2007) (link). The KD(P)GA after heat treatment was used as auxiliary enzyme for the characterization of CcEDD. The assay mixtures (0.5 ml) contained 100 mM HEPES buffer pH 8.0, 0.2 mM NADH, 0.675 μg purified CcEDD, 3 U L -lactate dehydrogenase (rabbit muscle, Sigma-Aldrich) and 50 μg Saci KD(P)GA-aldolase. After 2 min preincubation at 37°C 6PG was added to start the reaction and the oxidation of NADH to NAD+ was followed in a Specord 210 Photometer at 340 nm (Analytik Jena, ε(NADH) = 6.22 mM–1cm–1). All measurements were performed in triplicates.
L lactate dehydrogenase
Manufactured by Merck Group
Sourced in United States
L-lactate dehydrogenase is an enzyme that catalyzes the interconversion of lactate and pyruvate, playing a key role in cellular energy metabolism. It is a frequently used laboratory reagent for various biochemical and diagnostic applications.
Automatically generated - may contain errors
Lab products found in correlation
Pyruvate kinase, by Merck Group (6 mentions)
β nicotinamide adenine dinucleotide, by Merck Group (2 mentions)
Alcohol dehydrogenase, by Merck Group (1 mentions)
Formate dehydrogenase, by Merck Group (1 mentions)
Diaphorase, by Merck Group (1 mentions)
H2so4, by Carl Roth (1 mentions)
Lambda 25 uv vis spectrophotometer, by PerkinElmer (1 mentions)
Porcine trypsin, by Promega (1 mentions)
Lysozyme from chicken egg white, by Merck Group (1 mentions)
Human insulin solution, by Merck Group (1 mentions)
Porcine lipase, by Merck Group (1 mentions)
Bovine liver catalase, by Merck Group (1 mentions)
Bovine plasma fibronectin, by Merck Group (1 mentions)
Human serum albumin (hsa), by Merck Group (1 mentions)
α chymotrypsin, by Merck Group (1 mentions)
Human holo transferrin, by Merck Group (1 mentions)
Horse skeletal muscle myoglobin, by Merck Group (1 mentions)
Concanavalin a from jack bean, by Merck Group (1 mentions)
Alcohol dehydrogenase from saccharomyces cerevisiae, by Merck Group (1 mentions)
Cytochrome c, by Merck Group (1 mentions)
20 protocols using l lactate dehydrogenase
1
Enzyme-Coupled KGDP Aldolase Assay
2
Enzymatic Assay for Metabolite Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The enzymes alcohol dehydrogenase (ADH, Enzyme Commission number (EC) 1.1.1.1, 310 U mg−1) from Saccharomyces cerevisiae, formate dehydrogenase (FDH, EC 1.2.1.2, 0.49 U mg−1) from Candida boidinii, l -lactate dehydrogenase (l -LDH, EC 1.1.1.27, 174.5 U mg− 1 d -lactate dehydrogenase (d -LDH, EC 1.1.1.28, 213 U mg−1) from Lactobacillus leichmanii, and diaphorase (DIA, EC 1.8.1.4, 51 U mg−1) from Clostridium kluyveri were purchased from Sigma-Aldrich (St. Louis, MO, USA). Bovine serum albumin (BSA), glutaraldehyde solution (GA) (25% in H2O), glycerol, potassium ferricyanide (K3[Fe(CN)6]), sodium d -lactate, and ethanol standard solution were also supplied by Sigma-Aldrich. Sodium formate, sodium l -lactate, and the cofactor nicotinamide adenine dinucleotide (NAD+) were obtained from AppliChem (Darmstadt, Germany). Potassium phosphate buffer (K2HPO4, KH2PO4) and H2SO4 were from Carl Roth GmbH & Co. KG (Karlsruhe, Germany).
All reagents were of analytical grade and were prepared in deionized water. Enzymatic stock solutions (ADH, DIA, FDH,d -LDH and l -LDH, respectively) were prepared in 0.1 mol L−1 potassium phosphate buffer (pH 7.5). The DIA solution was supplemented with 0.5 mmol L−1 flavin adenine dinucleotide.
All reagents were of analytical grade and were prepared in deionized water. Enzymatic stock solutions (ADH, DIA, FDH,
3
Kinetic Analysis of Actin-Activated ATPase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The actin-activated ATPase activity of all PfMyoA constructs was determined at 30 °C in 10 mM imidazole pH 7.5, 5 mM KCl, 1 mM MgCl2, 1 mM EGTA, 1 mM DTT, and 1 mM NaN3 as a function of skeletal actin concentration. The salt concentration was kept low (5 mM) to minimize Km values and reach Vmax with actin concentrations that are compatible with this assay. Actin-activated ATPase activity was determined using a linked assay, which couples the regeneration of hydrolyzed ATP to the oxidation of NADH to NAD+. Pyruvate kinase (Sigma), in the presence of phophoenolpyruvate (Sigma) and low ADP concentrations, regenerates ATP. In a subsequent reaction, pyruvate is converted to lactate by L-lactate dehydrogenase (Sigma) which oxidizes NADH (Sigma) to NAD+. The decrease in optical density at 340 nm as a function of time was measured on a Lambda 25 UV/VIS spectrophotometer (Perkin Elmer), with a 300 s data monitoring window sampled every 2 s. Data were fit to the Michaelis–Menten equation.
4
Nsp13 ATPase Activity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ATPase assay was performed using the two enzyme coupling method as follows. The two enzymes, pyruvate kinase and l -lactate dehydrogenase (from Sigma) were added to the 200 μl reaction buffer system with final concentration as 100 units/ml and 200 units/ml respectively. Phosphoenolpyruvate (PEP, from SIGMA) and NADH were also added as co-factors for enzyme coupling. 20 nM Nsp13 was incubated with a ssDNA in a buffer containing 50 mM MOPS pH 7.0, 10 mM MgCl2 and 50 mM NaCl for 5 min. Varying concentrations of ATP were then added to initiate the reaction and the OD340 nm value of NADH was measured using the Perkin-Elmer Envision. The Km value was calculated using GraphPad Prism.
5
Protein Immobilization on Gold Slides
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteins: lysozyme
from chicken egg white, α-chymotrypsin from bovine pancreas,
insulin solution human, recombinant bovine serum albumin, horse skeletal
muscle myoglobin,l -lactate dehydrogenase from rabbit muscle,
human holo-transferrin, concanavalin A from jack bean, bovine plasma
fibronectin, alcohol dehydrogenase from Saccharomyces
cerevisiae, porcine lipase, bovine liver catalase,
human serum albumin, and cytochrome c from equine heart were purchased
from Sigma-Aldrich. Porcine pepsin and porcine trypsin were purchased
from Promega. Serum from human male AB plasma, USA origin, sterile-filtered
was purchased from Sigma-Aldrich. Proteins and the human serum were
spotted and dried onto separate gold slides 3 times to obtain protein
films.
from chicken egg white, α-chymotrypsin from bovine pancreas,
insulin solution human, recombinant bovine serum albumin, horse skeletal
muscle myoglobin,
human holo-transferrin, concanavalin A from jack bean, bovine plasma
fibronectin, alcohol dehydrogenase from Saccharomyces
cerevisiae, porcine lipase, bovine liver catalase,
human serum albumin, and cytochrome c from equine heart were purchased
from Sigma-Aldrich. Porcine pepsin and porcine trypsin were purchased
from Promega. Serum from human male AB plasma, USA origin, sterile-filtered
was purchased from Sigma-Aldrich. Proteins and the human serum were
spotted and dried onto separate gold slides 3 times to obtain protein
films.
6
V1ΔHC ATPase Activity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The rate of ATP hydrolysis by the purified V1ΔHC was measured with an ATP-regenerating NADH-coupled assay (Lotscher et al., 1984 (link)). The measurement was made with the final concentration of 25 mM Tris/HCl (pH 8.0), 60 mM KCl, 2.5 mM phosphoenolpyruvate, 0.3 mM NADH, 17.5 Units pyruvate kinase (rabbit muscle, Sigma Aldrich), 25 Units L-lactate dehydrogenase (rabbit muscle, Sigma Aldrich), at varying concentrations of ATP including 1, 0.5, 0.2, 0.1, 0.05, 0.02, 0.01 mM, twice the MgCl2 concentration for each corresponding ATP concentration, and 3.22 × 10−5 mM of purified V1ΔHC (0.0174 mg/mL) in a final volume of 2.5 mL. The rate was determined in three replicates as the change in absorbance at 340 nm using a Cary 100 spectrophotometer with Peltier temperature control at 25°C. MgATP concentration was determined by the Maxchelator program MgATP calculator v1.3 using constants from NIST database #46 v8 (UC Davis Health).
7
Kinase Activity Assay for Mtb MaK
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Kinase activity was estimated by a linked spectrophotometric assay that uses pyruvate kinase and L-lactate dehydrogenase as auxiliary enzymes to monitor the conversion of ATP to ADP with an observable decrease in the absorption of NADH at 340 nm36 (link). 100 μL of the reaction mixture contained 2 μg MtbMaK, 10 mM MgCl2, 1.5 mM ATP, and 5 mM maltose suspended in a buffer made up of 20 mM Tris-HCl, pH 8.0, 150 mM NaCl. 3 U of pyruvate kinase, 3 U of L-lactate dehydrogenase, 0.3 mM NADH and 2.5 mM phosphoenolpyruvate (all from Sigma-Aldrich), were added and the mixture incubated at 37° C for 30 min. The change in A340nm value was measured using a VarioshanFlash spectrophotometer (Thermo Scientific) over the course of the incubation period. The velocity of formation of the product ADP was calculated. The Km value of MtbMaK for maltose was determined from the Lineweaver-Burk plot constructed by measuring enzyme activity using different concentrations of the substrate.
8
Comprehensive Biophysical Characterization of PEGylated Hydrogels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polyethylene glycol (PEG) 4000 Da (A16151) was purchased from Alpha-Aesar. Bovine serum albumin (BSA) (A7638), Potassium phospate dibasic trihydrate (60349), 3-(Trimethoxysilyl)propylmethacrylate (440159), 2-Hydroxy-4′-(2-hydroxyyethoxy)-2-methylpropiophenone (410896), Poly(ethylene glycol) diacrylate (PEGDA) 700 Da (455008), l -lactate dehydrogenase (LDH) from muscle rabbit (L1254), Jack bean urease (U4002), β-Nicotinamide adenine dinucleotide, reduced disodium salt hydrate (NADH) (N8129), Pyruvate (P8524), Lactate assay Kit (MAK064), Phenol nitroprusside solution (P6994), Alkaline hypochlorite solution (A1727), Urease Activity Assay Kit (MAK120), Rhodamine-B (R6626) were purchased from Sigma-Aldrich. Potassium phosphate monobasic (42420) was purchased from Acros Organics. Deuterium oxide (D2O) (DE50B) was purchased from Apollo. N,N-dimethylformamide (DMF) (D119) was purchased from Fisher Chemicals. Alexa Fluor 594 and 488 Microscale Protein Labeling Kit (A30008 and A30006) and Carboxylic acid, Acetate, Succinimidyl Ester SNARF-1 (S2280) were purchased from Thermo Fischer Scientific. Trichloroacetic acid (TCA) (34603) was purchased from Nacalai Tesque. Fluorescent polystyrene nanoparticles tracers of 0.2 and 1 μm of diameter (FCDG003, FCDG006) were purchased from Bangs Laboratories. Fluorescein isothiocyanate (FITC) (AB178737) was purchased from abcr.
9
Measuring Lactate Secretion in Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The amount of lactate the cancer cells secreted into the culture medium was measured using an enzymatic assay using L-lactate dehydrogenase (Sigma). In this assay, the lactate secreted into the culture medium sample is reduced to pyruvate and NADH in the presence of lactate dehydrogenase (LDH) (Sigma) and excess NAD. The amount of NADH formed in the reaction, measured by the change in absorbance at 340 nm, is proportional to the concentration of lactate present in the sample. To avoid interference with the LDH that may already be present in the serum used to supplement the culture medium, the samples were subjected to deproteinization with 8% trichloroacetic acid (TCA) to render them protein-free prior to the assay.
10
Linked-Enzyme ATPase Activity Assay
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!