A Trizol reagent was used to extract RNA from AGE1.HN cells following SCI induction and spinal cord tissue samples (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). RNA was reverse transcribed into cDNA using the First Strand cDNA Synthesis kit (GeneCopoeia, Inc., Rockville, MD, USA). qPCR was performed using the ABI 7300HT real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the SYBR green supermix (Bio-Rad Laboratories, Inc., Hercules, CA, USA) The thermocycling conditions were as follows: 95°C for 10 min, followed by 40 cycles at 95°C for 30 sec, 58°C for 45 sec and 72°C for 30 sec. Relative gene expression was assessed using the 2−∆∆Cq method (17 (link)).
Abi 7300ht real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 7300HT real-time PCR system is a laboratory instrument designed for performing real-time polymerase chain reaction (PCR) analysis. It is capable of detecting and quantifying nucleic acid sequences in real-time during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
First strand cdna synthesis kit, by GeneCopoeia (1 mentions)
Sybr green supermix, by Bio-Rad (1 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Takara Bio (1 mentions)
Mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Powerup sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Total rna isolation kit, by Solarbio (1 mentions)
5 protocols using abi 7300ht real time pcr system
1
RNA Extraction and qPCR Analysis of SCI Samples
2
Quantifying miRNA-150-3p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total miRNA was extracted from tissues using the mirVana miRNA Isolation Kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. Real-time PCR assay was performed to detect the expression of miR-150-3p in tissues. Briefly, 10 µg of Micro RNA was subjected to reverse transcription. The cDNA was amplified through PCR and U6 was used as the endogenous control. The PCR primers used were as follows: miR-150 (GenBank accession number NR049590.1 ) forward, 5-CAG TAT TCT CTC CCA ACC CTT GTA-3 and reverse 5-AAT GGA TGA TCT CGT CAG TCT GTT-3; U6 (GenBank accession number XR003481952.1 ) forward, 5-ATT GGA ACG ATA CAG AGA AGA TT-3 and reverse, 5-GGA ACG CTT CAC GAA TTT G-357 (link). The PCR conditions were: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, 62 °C for 30 s, and 72 °C for 30 s57 (link). Real-time PCR was performed using SYBR Green PCR MasterMix (Applied Biosystems) on an ABI 7300HT real-time PCR system (Applied Biosystems, Foster City, CA, USA). The expression of U6 was used to normalize the relative expression of miR-150-3p. For the purpose of data analysis, the comparative cycle threshold (CT) method was used.
3
Quantitative Analysis of RNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Applied Biosystems, Foster City, CA). Complementary DNA was synthesized with Reverse Transcription kit (Applied Biosystems). Quantitative reverse transcription-polymerase chain reaction (RT-PCR) analyses were performed in triplicate with the SYBR® Green PCR Master Mix (TaKaRa, Otsu, Shiga, Japan) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. The data analysis was performed using the 2−ΔΔCT method as ΔΔCT = (CTTarget1-CTGAPDH) - (CTTarget2-CTGAPDH).
The miRNA fraction in tumor tissues and cells was extracted with miRNA isolation kit (Applied Biosystems). MiRNA-specific reverse transcription was performed with TaqMan® MicroRNA Reverse Transcription kit (Applied Biosystems). Quantitative RT-PCR was performed using TaqMan® Universal PCR Master Mix (Applied Biosystems) on an ABI 7300HT real-time PCR system (Applied Biosystems), and U6 small nuclear RNA was used as an internal control.
The miRNA fraction in tumor tissues and cells was extracted with miRNA isolation kit (Applied Biosystems). MiRNA-specific reverse transcription was performed with TaqMan® MicroRNA Reverse Transcription kit (Applied Biosystems). Quantitative RT-PCR was performed using TaqMan® Universal PCR Master Mix (Applied Biosystems) on an ABI 7300HT real-time PCR system (Applied Biosystems), and U6 small nuclear RNA was used as an internal control.
4
Quantifying Inflammatory Markers in Colon Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from colon tissue using a total RNA isolation kit (Solarbio Tech Co., Ltd., Beijing, China) following the manufacturer’s instructions, then reverse-transcribed into cDNA using HiScript II reverse transcriptase (EVazyme Biotech Co., Ltd., Nanjing, China). The qPCR primers were designed and synthesized (Genscript, Nanjing, China). The forward and reverse sequences are shown in Table 1 . Quantitative real-time PCR reactions were performed using Power Up SYBR Green PCR Master Mix on an ABI 7300 HT Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The expression of the target genes was normalized to that of GAPDH. Relative expression levels are shown as fold changes relative to the control.
List of Primers for Real-Time PCR
| Gene Name | Sequence 5′-3′ | |
|---|---|---|
| NLRP3 | F | CTCACCTCACACTCCTGCTG |
| R | AGAACCTCACAGAGCGTCAC | |
| GPR43 | F | ATCCTCACGGCCTACATCCT |
| R | CGCCAGGGTCAGATTAAGCA | |
| Caspase-1 | F | GACCGAGTGGTTCCCTCAAG |
| R | GACGTGTACGAGTGGGTGTT | |
| IL-1β | F | AACTGTGAAATAGCAGCTTTCG |
| R | CTGTGAGATTTGAAGCTGGATG | |
| IL-8 | F | CATTAATATTTAACGATGTGGATGCGTTTC |
| R | GCCTACCATCTTTAAACTGCACAAT | |
| GAPDH | F | ACAGCAACAGGGTGGTGGAC |
| R | TTTGAGGGTGCAGCGAACTT |
5
Quantitative PCR for miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mRNA and miRNA quantifications, quantitative real-time PCR assay was performed to respectively detect the expression levels of miR-150 and ZEB1 in cell lines and tissues. Briefly, 10 µg of small RNA and 20 µg of total RNA was subjected to reverse transcription. The cDNA was used for the amplification of mature miR-150, ZEB1 and the endogenous controls, U6 and β-actin, by PCR. The PCR primers used were as follows: miR-150 forward, 5′-CAG TAT TCT CTC CCA ACC CTT GTA-3′ and reverse 5′-AAT GGA TGA TCT CGT CAG TCT GTT-3′ , U6 forward, 5′-ATT GGA ACG ATA CAG AGA AGA TT-3′ and reverse, 5′-GGA ACG CTT CAC GAA TTT G-3′; ZEB1 forward 5′-CAG GCA GAT GAA GCA GGA TG-3′ and reverse 5′-CAG CAG TGT CTT GTT GTT GTA G-3′; β-actin forward 5′-GGC GGC ACC ACC ATG TAC CCT-3′ and reverse 5′-AGG GGC CGG ACT CGT CAT ACT-3′ . The PCR conditions were: initial denaturation at 95°C for 3 min, followed by 40 cycles of 95°C for 15 s, 62°C for 30 s, and 72°C for 30 s.
Real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems) on an ABI 7300HT real-time PCR system (Applied Biosystems, Foster City, CA, USA). Standard curves were generated, and the relative amount of miR-150 or ZEB1 was normalized to the amount of U6 or β-actin, respectively. Relative quantification of target gene expression was evaluated using the 2−△△CT method.
Real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems) on an ABI 7300HT real-time PCR system (Applied Biosystems, Foster City, CA, USA). Standard curves were generated, and the relative amount of miR-150 or ZEB1 was normalized to the amount of U6 or β-actin, respectively. Relative quantification of target gene expression was evaluated using the 2−△△CT method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!