Avian myeloblastosis virus transcriptase

Total RNA was extracted from endometrial carcinoma cell lines and endometrial cancer tissue using TRIzol (Takara, Japan). Total RNA (2 μg) was reverse transcribed to complementary DNA (cDNA) using avian myeloblastosis virus transcriptase and random primers (Takara, Shiga, Japan). The oligonucleotide primers for PCR were based on GenBank sequences. RT-PCR amplification of the cDNA was performed in 20 μL reactions according to the SYBR Premix Ex Taq™ II kit (Takara, Shiga, Japan); 18S rRNA was used as the internal control.

Total RNA was harvested using TRIzol (Invitrogen). Enriched miRNA was isolated using a miRNA isolation kit (TakaRa). A stem-loop reverse transcription-polymerase chain reaction (RT-PCR) was also executed on the samples to detect and quantify mature miRNAs using stem-loop antisense primer mix and avian myeloblastosis virus transcriptase (TaKaRa).
The cDNA preparations were routinely tested by real-time PCR based on the SYBR Green I method, according to the manufacturer’s instructions (TaKaRa). The amplification and detection of specific products were performed according to the manufacturer’s protocol with the iQ5 system (BioRad). The U6 small nucleolar RNA was used as the housekeeping small RNA reference gene. The relative gene expression was normalized to U6 small nucleolar RNA. Each reaction was performed in triplicate, and analysis was performed by the 2^−△△CT method. The nucleotide primers used for reverse transcription were as follows (5'−3'): miR-19a, GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGTT; U6, GTCGT ATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAA ATATG. The nucleotide primers used for real-time PCR were as follows (5'-3'): miR-19a forward, GCGTGTGCAAATCTATGCAA; U6 forward, GCGCGTCGTGAAGCGTTC; universal reverse primer, GTGCAGG GTCCGAGGT.

Total RNA enriched with miRNAs was extracted from liver tissues using the mirVana^™ miRNA Isolation kit (Ambion, Austin, TX, USA) and subjected to direct labeling with an Hy3^™ fluorescent label using the miRCURY^™ Array Labeling kit (Exiqon, Vedbæk, Denmark). Subsequent to labeling, the RNA was concentrated with the RNeasy Mini kit (Qiagen, Hilden, Germany) followed by hybridization using the miRCURY^™ Array Microarray kit (Exiqon, Vedbaek, Denmark). The hybridized arrays were scanned with the Genepix 4000B scanner (Axon Instruments, Sunnyvale, CA, USA) and the microarray images were background-subtracted, normalized and subjected to further analysis. Mature miRNAs with comparative expression levels of >2.0 or <0.5 between AFL and C12, or ASH and C16 were considered as dysregulated miRNAs.
To further validate the expression levels of significantly dysregulated miRNAs revealed by microarray, stem-loop qPCR was performed with stem-loop antisense primer mix (Applied Biosystems, Foster City, CA, USA) and Avian Myeloblastosis Virus transcriptase (Takara Bio, Inc., Dalian, China). All PCR primers were designed based on miRNA sequences released by the Sanger Institute (16 (link)). The relative quantity of each miRNA was normalized to U6 RNA and calculated using the following equation: 2^−ΔCT, where ΔC_T = C_TmiRNA-C_TU6.