Ap conjugated anti dig antibody

Whole-mount in situ hybridization (WISH) with a riboprobe was previously described [44 (link)]. In situ hybridization (ISH) on cryosections was previously described [25 (link)]. The Shox2 [43 ], Shh [45 (link)] riboprobes have been described elsewhere. PCR primers used for generating the Ptch1 riboprobe are as follows: Fwd: GGGAGGAAATGCTGAATAAAGCC and Rev: CCAGGAGGAAGACATCATCCACAC, while the primers used for generating the Isl1, Cntn2, Tubb3, Periph, Slc18a3, Phox2b, and Slit2 riboprobes were obtained from the Allen brain atlas website (http://www.brain-map.org). DIG labeled riboprobes were detected with an AP-conjugated anti-DIG antibody (Roche) and BM Purple AP (Roche) was used as the color development substrate. All samples/slides used for comparisons were processed together. Following staining, tissue sections were mounted using Aqua Poly/Mount (Polysciences Inc.). ISH images were taken with a Leica MZ12.5 stereomicroscope using the associated Leica software. Brightness and/or contrast of the entire image was adjusted using Adobe Photoshop CS5.1 if deemed appropriate.

In situ hybridisation (ISH) was carried out as previously described^{40 (link)}. Briefly, mice were perfused with 4% PFA in phosphate buffer using DEPC-treated water, and the brain tissue was dissected and post-fixed in the same buffer overnight. The tissue was frozen on the next day, and brain sections (20 μm) were prepared within a week. The sections were treated with 0.1 N HCl and Protease K, fixed, and acetylated. After pre-hybridisation in 50% formamide, 2x SSC, 1x Denhardt’s, 10 mM EDTA, 50 mg/ml tRNA, and 0.01% Tween20 at 55 °C for 1-2 h, the sections were hybridised with digoxigenin (DIG)-labelled RNA probes prepared using the DIG RNA labelling kit (Roche, #11175025910) in pre-hybridisation buffer supplemented with 5% dextran sulphate at 55 °C overnight. After RNaseH treatment to digest the unhybridised DIG-RNA, the brain sections were intensively washed with a low ionic buffer, and incubated with AP-conjugated anti-DIG antibody (Roche). The signal was visualised with NBT-BCIP. A fragment (1083–2036 nt) of the mouse Rfk gene (NM_019437) was cloned into pBluescript II and used as the template for probe synthesis.

Cultured skin explants or embryos were fixed overnight in 4% PFA at 4°C, dehydrated through a methanol series, bleached in 5% hydrogen peroxide (H₂O₂), and then rehydrated into PBS. Samples were treated with 20 μg/ml proteinase K, postfixed in 4% PFA containing 0.2% glutaraldehyde, and hybridised with a digoxigenin (DIG)-labelled riboprobe for single in situ hybridisation or in combination with a 2, 4-dinitrophenyl (DNP)-labelled riboprobe for double in situ hybridisation. Unbound probe was removed via washing prior to DIG-labelled probe detection using 1/1,000 alkaline phosphatase (AP)-conjugated anti-DIG antibody (Roche) followed by signal detection using 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium (BCIP/NBT).
For double in situ hybridisation, after the first colour reaction, samples were postfixed in 4% PFA for 30 minutes at room temperature. DNP-labelled riboprobe was detected using 1/1,000 AP-conjugated anti-DNP antibody (Vector) and then coloured using BCIP/2-(4-iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium chloride (INT).

In situ hybridization was performed as described previously with slight modifications [19] (link). In brief, retinal slices were rehydrated and permeabilized using 5 µg/mL proteinase K (Life Technologies) at 25°C for 5 min. After acetylation and prehybridization, the slices were incubated with a digoxigenin (DIG)-labeled antisense complementary RNA (cRNA) probe overnight at 55°C. The next day, the excess probe was washed off, and the slices were incubated with an alkaline phosphatase (AP)-conjugated anti-DIG antibody (1∶500 dilution; Roche Applied Science, Mannheim, Germany) overnight at 4°C. On the third day, the slices were washed, and the positive signals were visualized by means of nitro blue tetrazolium (NBT)/5-bromo-4-chloro-3-indolyl phosphate (BCIP; Roche Applied Science). The slices incubated with a sense probe served as a negative control.