Gene knockout kit v2

TrueCut Cas9 protein-v2 (ThermoFisher, A36499), 10 pmol per target, was incubated with 30 pmol sgRNA (Gene Knockout Kit v2, Synthego) per target (Table 1). Isolated naïve and total B cells were washed in PBS and resuspended in Buffer T (Neon Transfection System). 350,000 cells were transfected with Cas9/RNP complexes and infected with B95-8 virus as described above. Outgrowth was assessed by flow cytometry upon staining cells with anti-CD46 (Table 1).

Exon‐2 in the IL24 gene was ablated in melanoma A375 cells using a Gene Knockout Kit v2 (Synthego, Redwood City, CA, USA) with multi‐guide sgRNA's (gRNA1‐GAGGCUGUCGCCAGCAA, gRNA2‐CUCUGGAGCCAGGUAUC, gRNA3‐ACCCCCUUCACUUGGCA). To optimize the knockout efficiency, cells were seeded at different densities in a 24‐well plate. A mixture of three different modified sgRNA's were mixed with purified CAS9 and then transfected into cells using Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent (Thermo Fisher Scientific, CMAX00001). After 72 h, cells with different seeding densities were checked for CRISPR edits using exon‐specific PCR and analysis using the ICE CRISPR tool. Cells with the most CRISPR edits were then cloned by serially diluting them into 96‐well plates and then cultured until colonies formed. Individual colonies were checked for IL24 gene expression by immunoblotting to detect IL24 protein. Clones with no IL24 expression were then checked for ablation of the IL24 gene using exon‐specific PCR.

A CRISPR/Cas9 knockout kit targeting CD40 (Gene Knockout Kit v2) was obtained through Synthego. The kit consisted of recombinant Cas9 protein and three sgRNAs with the following sequences: (i) AAUCUGUUGACCCCAAGC, (ii) AGGCUGGCACUGUACGAGUG, and (iii) UCUUCUCAGACCUAGGGCUU. sgRNAs and Cas9 protein (RNP mixture) were prepared as per Synthego’s instructions. For electroporation, the Neon Transfection system (ThermoFisher Scientific) was filled with 3 mL of electrolytic buffer and the following settings were used: voltage = 1400, width = 20, pulses = 2. Cells were trypsinized with TrypLE, neutralized with DMEM containing 10% FBS, and centrifuged at 1250 revolutions/min (RPM) for 5 min. Approximately 5 × 10⁵ cells were pelleted, and the conditioned medium was removed. Cells were then resuspended in 12 µL of 3:1 Resuspension Buffer R and premixed RNP. Reaction mix (10 µL) was used for electroporation. Electroporated cells were added to a 6-well plate containing prewarmed media and expanded.

Clonal knockout lines in THP-1 cells were generated by electroporation of multiplexed small guide RNA (sgRNA) from Gene Knockout Kit v2 (Synthego, Redwood City, CA) against TRIM34 (guide sequences = CTTGCTTAACGTACAAG, CCACAGTCTAGACTCAA, GCAGTGACCAGCATGGG) or TRIM5 (guide sequences = GGUAACUGAUCCGGCACACA, ACUUCUUGUGGUUUGCAGUG, CCUGGUUAAUGUAAAGGAGG). Single cell clonal lines were generated by single cell sorting (TRIM34) or limiting dilution (TRIM5). Knockout efficiency was validated by Interference of CRISPR Edits (ICE) analysis (Synthego) [62 (link)] (Additional file 1:Chromatograms S1, S6–S10).
Pooled knockout lines were generated by transduction of THP-1 cells with lentiviral preps containing guides delivered by pLentiCRISPR-v2. TRIM5 guide sequences = TCACCACACGTTCCTCACAG and GTTGATCATTGTGCACGCCA. NTC guide sequences = GGGCCCGCATAGGATATCGC and TAGACAACCGCGGAGAATGC. Cells were spinoculated in the presence of 20 µg/mL DEAE-Dextran (Pharmacia Fine Chemicals, Uppsala, Sweden, #17-0350-01) and then selected in 10 µg/mL blasticidin S HCl (Gibco #A11139-03). Knockout efficiency was validated by ICE analysis[62 (link)] (Additional file 1: Chromatograms S2–S5).

PIP5K1C knockout was carried out using Gene Knockout Kit v2 (Synthego) with multi-guide sgRNA’s against exon-3 of the PIP5K1C gene. Briefly, three different nucleotides modified sgRNA’s were mixed with purified CAS9 and cells were transfected using Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent (ThermoFisher, CMAX00001). After 72 h, the cells were diluted so that single cells could be isolated in 96-well plates and then cultured into colonies. Individual colonies were checked for PIP5K1C expression by immunoblotting PIP5K1C protein. Selected clones with low PIP5K1C expression were then checked for ablation of the PIP5K1C gene using exon-specific PCR.

CRISPR/Cas9 knock out cells were created analog to Wöhner et al.^{22 (link)}. Shortly, material was purchased from Synthego (Gene Knockout Kit v2, Synthego Corporation, Menlo Park, CA, USA). The following guides were used: guide_#1 (GGGCCUGAUGAUCCCUG), guide_#2 (UUCACAGUCACCUGUGA), guide_#3 (AGACUCCUUCUGCUUCC). H460 cells were transfected by electroporation using the Neon^™ Transfection System (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to manufacturer’s guidelines in duplicates. Single clone selection, DNA purification for further PCR analysis as well as sequencing and protein extraction for western blot analysis have followed. The forward primer 5’ GTTCCTTCTGTGCGGTTCGTG 3’ and reverse primer 5’ CCATCCTCTTCCCCTTCTCCC 3’ have been used for PCR analysis. After gel extraction of PCR products, H460 native cells and CRISPR/Cas9 clones were verified using sequencing primers 5’ TCTGTGCGGTTCGTGGTTTA 3’ and 5’ ATTGGCGCAGTATGGAGTG 3’ for Sanger sequencing perfomed by Azenta (Burlington, MA, USA). Primers were designed and bought from MilliporeSigma (Burlington, MA, USA). Sequencing data was analyzed using SnapGene Viewer Version 7.1.1 (GSL Biotech LLC, Boston, MA, USA).

To achieve gene knockout (KO) of ITGB1, NALM6 cells were mixed with ribonucleoprotein (RNP) complexes that consist of 10pmole of purified Cas9 nuclease duplexed with 90 pmol of multi-guide chemically modified ITGB1 synthetic single guide RNA (sgRNA) (predesigned Gene Knockout Kit v2, Synthego). The cells were then resuspended in 12μL of R Buffer (Thermo Fisher Scientific) for electroporation in the Neon Transfection System (Thermo Fisher Scientific). Cells were loaded in 10μL tips and electroporated according to the manufacturer’s instructions using the setting of 1410 V, 10ms width, and 3 pulse. Following electroporation, cells were recovered in RPMI (Thermo Fisher Scientific) containing 20% FBS (Thermo Fisher Scientific) for 24 h before undergoing another round of electroporation to increase the knockout efficiency. Cells were then harvested for single cell sorting 24 h later. Knockout efficiencies of all clones were analyzed by flow cytometry.