For further analysis of the array results, we selected miRNAs that were highly up-regulated in the standard healing fracture group. To compare the expression levels of the selected miRNAs between standard healing fractures and unhealing fractures and to investigate their changes in expression over time in standard healing fractures, real-time PCR was performed on RNA from tissue specimens collected on post-fracture days 3, 7, 10, 14, 21, and 28 (n = 5 in each group at each time point). Tissue specimens were homogenized with a T 18 ULTRA-TURRAX homogenizer (IKA Werke, Staufen, Germany) and total RNA, including miRNAs, was extracted using a miRCURY RNA Isolation Kit-Tissue. RNA used for real-time PCR assays did not include any of the RNA used in the microarray assay. Total RNA was reverse transcribed into single-strand cDNA using the miRCURY LNA Universal RT microRNA PCR kit (Exiqon). Real-time PCR analysis was performed in duplicate with a StepOne Sequence Detector (Applied Biosystems, Branchburg, NJ, USA), using SYBR Green master mix and microRNA LNA PCR primer sets (both from Exiqon). U6 was used as an internal control to normalize differences in miRNA levels in each sample. The relative abundance of each miRNA was calculated using the comparative ΔΔCT method, and is presented as the fold change relative to levels in the post-fracture day 3, standard healing fracture sample.
Mircury lna universal rt microrna pcr kit
Manufactured by Qiagen
Sourced in Denmark, Germany
The MiRCURY LNA Universal RT microRNA PCR kit is a laboratory equipment product designed for the detection and quantification of microRNA expression. It provides a universal reverse transcription (RT) and real-time PCR solution for microRNA analysis.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green master mix, by Qiagen (5 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Mirneasy mini kit, by Qiagen (5 mentions)
Mircury lna sybr green pcr kit, by Qiagen (5 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (4 mentions)
Mirneasy kit, by Qiagen (4 mentions)
Mircury rna isolation kit, by Qiagen (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Microrna lna pcr primer set, by Qiagen (2 mentions)
Stepone sequence detector, by Thermo Fisher Scientific (2 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Exilent sybr green master mix, by Qiagen (2 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Microrna lna primer sets, by Qiagen (2 mentions)
Universal cdna synthesis kit, by Qiagen (2 mentions)
Mirneasy serum plasma kit, by Qiagen (2 mentions)
U6 snrna, by Qiagen (2 mentions)
Quant it ribogreen rna assay kit, by Thermo Fisher Scientific (2 mentions)
Quantstudio 7 flex real time pcr system, by Thermo Fisher Scientific (2 mentions)
Mir 1202, by Qiagen (2 mentions)
37 protocols using mircury lna universal rt microrna pcr kit
1
Comparative Analysis of miRNA Expression in Fracture Healing
2
Quantification of miRNA and mRNA in HepG2 cells
3
Quantification of miRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine miRNA expression levels, total RNA was isolated using the miRNeasy Mini Kit (Qiagen). The miRCURY LNA Universal RT microRNA PCR kit (Exiqon) was used for reverse transcription and miRNA amplification. Expression was calculated using the ΔΔCT method and U6 was used as internal controls. Primers for miR-126* (cat. 204584) and U6 (cat. 203907) were purchased from Exiqon.
4
Quantification of miRNA-451a and TBX1 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total miRNA or mRNA from sample tissues or cells was harvested with miRNeasy mini kit from Qiagen. miRNA‐451a level was measured with miRCURY™ LNA™ Universal RT microRNA PCR kit from Exiqon. RUN6B RNA was used as normalization control. TBX1 (NG_009229.1 ) gene expression was analyzed with TaqMan® Assay kit from Thermo Fisher.
miRNA‐451a‐5p: 5′‐AAAAAAACCGTTACCATTACTGAGTT‐3′
TBX1 F: 5′‐CTGACCAATAACCTGCTGGATGA‐3′
TBX1 R: 5′‐GGCTGATATCTGTGCATGGAGTT‐3′
5
Quantification of Urinary miRNAs in NMIBC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 8 key miRNAs (miR-25-3p, miR-18a-3p, miR-92a-3p, miR-140-5p, miR-125b-5p, miR-142-3p, miR-204-5p and miR-187-3p), previously described by our group [13 (link)], were selected for examination in urinary samples from NMIBC patients by quantitative PCR by using miRCURY LNA Universal RT microRNA PCR kit (Exiqon, Vedbaek, Denmark), as previously described [13 (link)]. Briefly, total RNA (100 ng) containing miRNA was polyadenylated, and cDNA was synthesized using a poly(T) primer with a 3’ degenerate anchor and a 5’ universal tag. Then, cDNA was served as a template for miRNA RT-qPCR amplification with the specific locked nucleic acid (LNA) primers (Supplementary Table 2 ) and SYBR Green master mix. PCR reactions were carried out using a Light Cycler 480 instrument. The amplification profile was denatured at 95°C for 10 min followed by 45 amplification cycles of 95°C for 10s and 60°C for 1 min. At the end of the PCR cycles, melting curve analyses were performed. miR-103-3p and miR-30c-5p were used as endogenous controls, as previously described [13 (link), 41 (link)].
6
miRNA Profiling of Osteosarcoma Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the initial miRNA profiling analysis, 50 ng of total RNA from 23 fresh‐frozen OS samples, two OS, and three OB cell lines was reverse‐transcribed using the miRCURY LNA™Universal RT microRNA PCR kit (Exiqon) in a Mastercycler® pro S (Eppendorf, Hamburg, Germany) in a 50 μL reaction volume, comprising the Universal cDNA synthesis kit II, RNA Spike‐in kit (Exiqon) (Fig. 1 ). Quality control (QC) was performed according to the manufacturer's instructions using the ExiLENT SYBR® Green master mix kit (Exiqon), using 1 : 80 diluted cDNA. Quality of the cDNA synthesis and PCR amplification were evaluated through the detection of miR‐103, miR‐191‐5p, miR‐423, and UniSp6 at stable Cq levels (Cq < 32) (Fig. 1 ).
The miRNA profile was established using 45 ng cDNA from each sample by qPCR using the microRNA Ready‐to‐Use PCR, Human panel I and panel II v2 analyzing 752 miRNAs (Exiqon) on a Lightcycler® 480 V2 Real‐Time PCR System (Roche Applied Science, Penzberg, Germany) (Fig.1 ). The plates were set up using a Bravo Automated Liquid Handling Platform (Agilent Technologies Inc.).
The miRNA profile was established using 45 ng cDNA from each sample by qPCR using the microRNA Ready‐to‐Use PCR, Human panel I and panel II v2 analyzing 752 miRNAs (Exiqon) on a Lightcycler® 480 V2 Real‐Time PCR System (Roche Applied Science, Penzberg, Germany) (Fig.
7
Quantitative Analysis of Cardiac Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s specifications. cDNA was synthesized from 1 μg of RNA with a PrimeScript RT reagent kit with gDNA Eraser (Takara). Real-time PCR amplification reactions were performed with SYBR Premix Ex Taq kit with ROX (Takara) in triplicate using the ABI Prism 7900 Real-Time PCR machine. Gene expression was measured by the ΔΔCT method and was normalized to β-actin mRNA levels. The data are presented as the fold change in the expression of the gene of interest relative to the control groups. The primer sequences used were as follows: atrial natriuretic peptide (ANF) forward, 5-GGGGGTAGGATTGACAGGAT-3 and reverse, 5-GGATCTTTTGCGATCTGCTC-3; and brain natriuretic peptide (BNP) forward, 5- GCTGCTTTGGGCAGAAGATA -3’ and reverse, 5- GGAGTCTGCAGCCAGGAGGT -3; β-actin forward, 5- CGTTGACATCCGTAAAGACC -3 and reverse, 5- TAGAGCCACCAATCCACACA -3. For the miR-133a real-time PCR, we used a miRCURY LNA™ Universal RT microRNA PCR kit (Exiqon). Template RNA was adjusted to 5 ng/μl. cDNA synthesis was performed according to the manufacture’s instruction. The miR-133a and U6 expressions were evaluated by real-time PCR using the ABI PRISM 7900 Sequence Detection System. The miR-133a expression level was normalized to U6 expression following the ΔΔCT method. All real-time experiments have been repeated four times.
8
Profiling microRNA Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using the miRCURY RNA Isolation Kit-Cell&Plant (Exiqon) according to the manufacturer’s instructions. Isolated RNA was stored at -80° C after concentration and purity determination using a SpectrostarNano spectrophotometer (BMG Labtech). The integrity of each RNA sample was checked by agarose gel electrophoresis (0.8% (w/v) agarose/TAE gel). Prior to loading onto the agarose gel, samples were denaturated with 10% (v/v) formamide and heated at 70°C. cDNA was synthesized only from intact total RNA samples using the miRCURY LNA™ Universal RT microRNA PCR kit (Exiqon) according to the manufacturer’s instructions. For RT-PCR, Pick&Mix microRNA PCR Panel 96-well Ready-to-Use (Exiqon) plates were used together with LNA primers for the following micro RNAs: miR-155, miR-21a, miR-221 as well as miR-674a and miR-324 as control/housekeeping miRNAs. RT-PCR was performed using ExiLENT SYBR® Green master mix (Exiqon) according to the manufacturer’s instructions using a StepOne Real Time PCR System (Applied Biosystems).
9
RNA Extraction and Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions for inclusion of miRNAs. 1 μg of RNA was reversely transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). cDNA for miRNAs was synthesized using Universal cDNA Synthesis Kit II (Exiqon) following the manufacturer's protocol. mRNA and miRNA expression levels were measured using Power SYBR Green PCR Master Mix (Applied Biosystems) and miRCURY LNA Universal RT microRNA PCR-Kit (Exiqon), respectively. Expression values were measured on a Roche LightCycler 480 and normalized to β-Actin expression for mRNA and to miR-16 for miRNA. Relative expression for all samples were calculated using the Pfaffl method [69 (link)]
10
qPCR for microRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA synthesis was performed using the miRCURY LNA Universal RT microRNA PCR kit (Exiqon) according to the manufacturer’s instructions with the exception of withholding UniSp6. For cDNA synthesis, 2 μl of RNA was used. cDNA was diluted 1:40 for qPCR on a Bio-Rad CFX96 Real-Time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA) using the ExiLENT SYBR Green master mix and LNA PCR primers sets (Exiqon). Each sample was measured in duplicate. The Cq value was defined using Bio-Rad CFX Manager 3.1 software (the threshold was manually set at 300 relative fluorescent units (RFU) for each experiment). RNA isolated from the HT-29 colorectal cancer cell line (ATCC) was used as a positive control and nuclease-free H2O was used as a non-template negative control in each experiment. The maximum accepted variation between duplicates was set at a 0.6 standard deviation (s.d.). qPCR was repeated if the s.d. of the duplicate was >0.6. RNA isolation was repeated when the Cq value of spike-in cel-miR-39-3p was >30.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!