Log In Sign up
The largest database of trusted experimental protocols

IFNB1 is a laboratory product manufactured by Thermo Fisher Scientific. It is a recombinant human interferon beta-1, which is a naturally occurring protein involved in the body's immune response. The core function of IFNB1 is to induce antiviral and antiproliferative activities in cells.

Automatically generated - may contain errors

Lab products found in correlation

Gapdh, by Thermo Fisher Scientific (5 mentions) Ifna2a, by R&D Systems (3 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Cxcl10, by Thermo Fisher Scientific (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Ifna1, by Thermo Fisher Scientific (2 mentions) Gapdh hs02758991 g1, by Thermo Fisher Scientific (1 mentions) Rnase h, by Promega (1 mentions) Eukaryotic 18s rrna, by Thermo Fisher Scientific (1 mentions) Ifit1 isg56, by Thermo Fisher Scientific (1 mentions) Rnase free recombinant dnase 1, by Roche (1 mentions) Taqman fast universal pcr master mix, by Thermo Fisher Scientific (1 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions) Cxcl1, by Thermo Fisher Scientific (1 mentions) Il 10, by Thermo Fisher Scientific (1 mentions) Tumor necrosis factor (tnf), by Thermo Fisher Scientific (1 mentions) Cxcl2, by Thermo Fisher Scientific (1 mentions) Isg15, by Thermo Fisher Scientific (1 mentions) Abi prism 7500, by Thermo Fisher Scientific (1 mentions) Iscript cdna synthesis kit, by Bio-Rad (1 mentions)

15 protocols using ifnb1

1

Quantitative RT-PCR for Virus and Interferon Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cells using TRIzol Reagent (Ambion), and treated with RNase-Free Recombinant DNase I (Roche Diagnostics). After phenol-chloroform extraction and ethanol precipitation, purified total RNA was subjected to cDNA synthesis using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Gene expression levels were measured by the StepOnePlus Real-Time PCR system (Applied Biosystems) using the TaqMan Fast Universal PCR Master Mix (Applied Biosystems), and determined by the 2-ΔΔCt relative quantitative method. The TaqMan probes used for measurements were; IFNB1 (#Hs01077958_s1), ISG20 (#Hs00158122_m1), ISG56/IFIT1 (#Hs01911452_s1), CXCL10 (#Hs01124251_g1), IFNB1 (#Mm00439552_s1), Isg56/Ifit1 (#Mm00515153_m1), CXCL10 (#Mm00445235_m1), and eukaryotic 18S rRNA (#4333760F), all purchased from Applied Biosystems. The probe for NDV-N was designed as below: 5'-GTCCGTATTTGACGAATACGAG-3' (forward primer), 5'-CAAGGGCAACATGGTTCCTC-3' (reverse primer), and 5'-TCAGGCAAGGTGCTC-3' (probe).
Oh S.W., Onomoto K., Wakimoto M., Onoguchi K., Ishidate F., Fujiwara T., Yoneyama M., Kato H, & Fujita T. (2016). Leader-Containing Uncapped Viral Transcript Activates RIG-I in Antiviral Stress Granules. PLoS Pathogens, 12(2), e1005444.
+ Open protocol
+ Expand
2

Interferon and Inflammation Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
From the globin reduced RNA cDNA was synthesised using High Capacity cDNA Reverse Transcription kit (Applied Biosystems), according to the manufacturer’s instructions followed by RNase H (Promega) treatment for 30 min at 37°C. IFNB1, IL1A, IL6, NFKB1, NFKB2, STAT1, STAT2 and IRF7 gene expression were quantified by real-time PCR (7900HT, Applied Biosystems) using the TaqMan system, and normalised to GAPDH mRNA.
Primer probes used were IFNB1 (Hs01077958_s1); IL1A (Hs00174092_m1); IL6 (Hs00985639_m1); NFKB1 (Hs00765730_m1); NFKB2 (Hs010208901); STAT1 (Hs01013996_m1); STAT2 (Hs01013123_m1); IRF7 (Hs01014809_g1); GAPDH (Hs02758991_g1) (all Applied Biosystems).
Blankley S., Graham C.M., Howes A., Bloom C.I., Berry M.P., Chaussabel D., Pascual V., Banchereau J., Lipman M, & O’Garra A. (2014). Identification of the Key Differential Transcriptional Responses of Human Whole Blood Following TLR2 or TLR4 Ligation In-Vitro. PLoS ONE, 9(5), e97702.
+ Open protocol
+ Expand
3

Quantitative Transcriptional Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RNA isolation and qPCR was performed as described by the manufacturers Roche and Thermo, respectively with the following primers from Applied Biosystems: IFNB1 (Hs01077958_s1), ISG15 (Hs01921425_s1), IL6 (Hs00174131_m1), and CXCL10 (Hs01124251_g1). The mRNA level of the genes were normalized by β-actin using the formula 2Ct(βactin) − Ct(mRNA X). The resulting normalized ratio (NR) was presented directly in the figures.
Zhang B.C., Nandakumar R., Reinert L.S., Huang J., Laustsen A., Gao Z.L., Sun C.L., Jensen S.B., Troldborg A., Assil S., Berthelsen M.F., Scavenius C., Zhang Y., Windross S.J., Olagnier D., Prabakaran T., Bodda C., Narita R., Cai Y., Zhang C.G., Stenmark H., Doucet C.M., Noda T., Guo Z., Goldbach-Mansky R., Hartmann R., Chen Z.J., Enghild J.J., Bak R.O., Thomsen M.K, & Paludan S.R. (2020). STEEP mediates STING ER exit and activation of signaling. Nature immunology, 21(8), 868-879.
+ Open protocol
+ Expand
4

RT-qPCR Analysis of Antiviral Genes

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted using TRIzol Reagent (Invitrogen) and cDNA was generated with the iScript cDNA synthesis kit (Bio-Rad). TaqMan primer/probe sets for murine Setdb2, Ifna2, Ifnb1, Irf3, Irf7, Ccl2, Cxcl1, Cxcl2, Il10, Tnf, Il10, Tnf, Pkr, Rnasel, Isg15, Mx1, and human SETDB2 were purchased from Applied Biosystems. NS1 and M1 were detected using custom primers [5 (link)]. Gene expression was assessed using an ABI Prism 7500 instrument (Applied Biosystems) and normalized to Gapdh or ACTB.
Kroetz D.N., Allen R.M., Schaller M.A., Cavallaro C., Ito T, & Kunkel S.L. (2015). Type I Interferon Induced Epigenetic Regulation of Macrophages Suppresses Innate and Adaptive Immunity in Acute Respiratory Viral Infection. PLoS Pathogens, 11(12), e1005338.
+ Open protocol
+ Expand
5

Quantifying Interferon Pathway Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from CAL-1 cells per manufacturer’s instructions (Qiagen, Germantown, MD). The RNA was reverse transcribed into cDNA (QuantiTect RT Kit; Qiagen) and quantified by TaqMan-based real-time PCR (Applied Biosystems, Foster City, CA). The following TaqMan probes were used: IFNB1 (Hs02621180 s1), IRF1 (Hs00971960 m1), IRF3 (Hs01547283 m1), IRF5 (Hs00158114 m1), IRF8 (Hs0 0175238 m1), and GAPDH ((Hs02758991 g1) as an endogenous control (Applied Biosystems). GAPDH levels did not change upon stimulation or during siRNA gene silencing. Data were analyzed by StepOne Software v2.1 using GAPDH as an endogenous control.
Steinhagen F., Rodriguez L.G., Tross D., Tewary P., Bode C, & Klinman D.M. (2015). IRF5 and IRF8 modulate the CAL-1 human plasmacytoid dendritic cell line response following TLR9 ligation. European journal of immunology, 46(3), 647-655.
+ Open protocol
+ Expand
6

Quantitative Transcriptional Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RNA isolation and qPCR was performed as described by the manufacturers Roche and Thermo, respectively with the following primers from Applied Biosystems: IFNB1 (Hs01077958_s1), ISG15 (Hs01921425_s1), IL6 (Hs00174131_m1), and CXCL10 (Hs01124251_g1). The mRNA level of the genes were normalized by β-actin using the formula 2Ct(βactin) − Ct(mRNA X). The resulting normalized ratio (NR) was presented directly in the figures.
Zhang B.C., Nandakumar R., Reinert L.S., Huang J., Laustsen A., Gao Z.L., Sun C.L., Jensen S.B., Troldborg A., Assil S., Berthelsen M.F., Scavenius C., Zhang Y., Windross S.J., Olagnier D., Prabakaran T., Bodda C., Narita R., Cai Y., Zhang C.G., Stenmark H., Doucet C.M., Noda T., Guo Z., Goldbach-Mansky R., Hartmann R., Chen Z.J., Enghild J.J., Bak R.O., Thomsen M.K, & Paludan S.R. (2020). STEEP mediates STING ER exit and activation of signaling. Nature immunology, 21(8), 868-879.
+ Open protocol
+ Expand
7

Quantitative RT-PCR protocol for gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primers and probes for the following genes were obtained from Applied
Biosystems: Ifna6 (Mm01703458_s1), Ifnb1(Mm00439552_s1), Foxp3 (Mm00475162_m1), Tgfb1(Mm01178820_m1), Tbx21 (Mm00450960_m1), Ifng(Mm01168134_m1), Ccl5 (Mm01302427_m1), Cxcl10(Mm00445235_m1) and Gapdh (Mm99999915_g1). In some experiments, following
primers were used: mouse pan Ifna forward: CCTGAGAAGAGAAGAACACAGCC,
reverse: GGCTCTCCAGACTTTCTGCTCTG; mouse pan Ifnb forward: CCGAGCA
GAGATCTTCAGGAA; reverse: CCTGCAACCACCACTCATTCT; mouse Gapdh forward:
TCACCACCATGGAGAAGGC, reverse: GCTAAGCAGTTGGTGGTGCA. Gapdh was used as an
internal control. Relative expression levels compared with control samples were calculated
in each experiment using the ΔΔCt method.
Ohkuri T., Ghosh A., Kosaka A., Zhu J., Ikeura M., David M., Watkins S.C., Sarkar S.N, & Okada H. (2014). STING contributes to anti-glioma immunity via triggering type-I IFN signals in the tumor microenvironment. Cancer immunology research, 2(12), 1199-1208.
+ Open protocol
+ Expand
8

Interferon Effects on Skeletal Muscle Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Normal human skeletal muscle myoblasts (HSMMs) were cultured according to the protocol recommended by the supplier (Lonza). When 80% confluent, the cultures were induced to differentiate into myotubes by replacing the growth medium with differentiation medium (Dulbecco’s modified Eagle’s medium supplemented with 2% horse serum and L-glutamine). Two plates of cells were harvested before differentiation and then daily for 6 days.
To examine the effect of different types of interferon on complement expression we treated HSMMs daily with 100 U/L and 1000 U/L of IFNA2a (R&D, ref. 11100-1), IFNB1 (PeproTech, ref. 300-02BC), and IFNG (PeproTech, ref. 300-02), respectively, for 7 days. Treated cells were harvested for RNA extraction and subsequent RNA sequencing.
Casal-Dominguez M., Pinal-Fernandez I., Pak K., Muñoz-Braceras S., Milisenda J.C., Torres-Ruiz J., Dell′Orso S., Naz F., Gutierrez-Cruz G., Duque-Jaimez Y., Matas-Garcia A., Valls-Roca L., Garrabou G., Trallero-Araguas E., Walitt B., Christopher-Stine L., Lloyd T.E., Paik J.J., Albayda J., Corse A., Grau J.M., Selva-O’Callaghan A, & Mammen A.L. (2023). Coordinated local RNA overexpression of complement induced by interferon gamma in myositis. Scientific Reports, 13, 2038.
+ Open protocol
+ Expand
9

Interferon-Stimulated Genes in Muscle Myoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
We treated human skeletal muscle myoblasts (HSMMs) to identify the IFNB1 and IFNG-specific interferon-stimulated genes. Normal HSMMs were cultured according to recommended protocol by the manufacturer (Lonza). When 80% confluent, the cultures were induced to differentiate into myotubes by replacing the growth medium with differentiation medium (Dulbecco’s modified Eagle’s medium supplemented with 2% horse serum and L-glutamine). Differentiating HSMMs were treated daily with 100U/L and 1000U/L of IFNA2a (R&D, ref:11100–1), IFNB1 (PeproTech, ref:300–02BC), or IFNG (PeproTech, ref:300–02) for 7 days and then harvested for RNA extraction and subsequent RNA sequencing.
Furukawa T., Itoh M., Krueger N.X., Streuli M, & Saito H. (1994). Specific interaction of the CD45 protein-tyrosine phosphatase with tyrosine-phosphorylated CD3 zeta chain.. Proceedings of the National Academy of Sciences of the United States of America, 91(23), 10928-10932.
+ Open protocol
+ Expand
10

Interferon effects on myotube differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Normal human skeletal muscle myoblasts were cultured according to the protocol recommended by the supplier (Lonza). When 80% confluent, myoblasts were induced to differentiate into myotubes by replacing the growth medium with differentiation medium (DMEM-F12 [Lonza, ref. 12-719F] supplemented with 2% horse serum [Gibco, ref. 16050-122], insulin-transferrin-selenium [Gibco, ref. 41400-045], and penicillin-streptomycin-L-glutamine [Gibco, ref. 10378-016]). Cells were harvested before differentiation and then daily after differentiation for 6 days.
To examine the effect of different types of interferon on gene expression we treated the cells daily with 100 U/uL and 1000 U/uL of IFNA2a (R&D, ref. 11100-1), and IFNB1 (PeproTech, ref. 300-02BC), respectively, for 7 days. Then, the cells were harvested for RNA extraction and RNA sequencing.
Pinal-Fernandez I., Muñoz-Braceras S., Casal-Dominguez M., Pak K., Torres-Ruiz J., Musai J., Dell’Orso S., Naz F., Islam S., Gutierrez-Cruz G., Cano M.D., Matas-Garcia A., Padrosa J., Tobías-Baraja E., Garrabou G., Aldecoa I., Espinosa G., Simeon-Aznar C.P., Guillen-Del-Castillo A., Gil-Vila A., Trallero-Araguas E., Christopher-Stine L., Lloyd T.E., Liewluck T., Naddaf E., Stenzel W., Greenberg S.A., Grau J.M., Selva-O’Callaghan A., Milisenda J.C, & Mammen A.L. (2024). Pathogenic autoantibody internalization in myositis. medRxiv.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!