M mlv reverse transcriptase cdna synthesis kit
The M-MLV Reverse Transcriptase cDNA Synthesis Kit is a laboratory tool used for the conversion of RNA into complementary DNA (cDNA) molecules. The kit includes the M-MLV Reverse Transcriptase enzyme, which is responsible for catalyzing the reverse transcription reaction.
Lab products found in correlation
8 protocols using m mlv reverse transcriptase cdna synthesis kit
Quantitative PCR Analysis of miRNAs and mRNAs
Quantitative RT-PCR Analysis of Cell Signaling
Quantification of Gene Expression
RNA Extraction and RT-qPCR Analysis
Quantitative Gene Expression Analysis
Quantitative Real-Time PCR for miRNA and mRNA Analysis
Real-time PCR Analysis of Gene Expression
Primer information for each gene.
GenBank accession number | gene symbol | primer sequences (5′ → 3′) | |
---|---|---|---|
NM_001082253.1 | GAPDH | sense | GGAGAAAGCTGCTAA |
antisense | ACGACCTGGTCCTCGGTGTA | ||
XM_002724032.2 | BMP7 | sense | GGGCTTCTCCTACCCCTACA |
antisense | TTGTCGTGTTCCACGAGGTT | ||
NM_001177330.1 | LPL | sense | GAAACTCAAGTGGAACAGCGAC |
antisense | TCAGAGACTTGTCGTGGCATTT | ||
NM_001171013.1 | MCP2 | sense | AAGTCGTAGACCAGCAGCCC |
antisense | GCAGCAGAGTGGGTGGATTCT | ||
XM_002716499.3 | SST | sense | CCCAACCAGACGGAGAATGA |
antisense | AGGGATTCTGGGGGATTAGG |
Kidney RNA Isolation and qRT-PCR Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!