MAE_06010 gene from Microcystis aeruginosa NIES-843 and MiAbW_01735 gene from Microcystis aeruginosa NIES-4325 were optimized according to the codon usage in E. coli and synthesized by GENEWIZ (Suzhou, China). The chaperone plasmids set (pG-KJE8, pGro7, pKJE7, pG-Tf2, pTf16) was from Takara Bio Inc. (Dalian, China). EasyPfu DNA polymerase, T4 DNA ligase, DNA marker, Fast Mutagenesis System and FlyCut endonucleases were obtained from TransGen Biotech (Beijing, China). SSADH was purified by our laboratory [35 (link),36 (link)]. The gene names used in this study were adopted from CyanoOmicsDB (http://www.cyanoomics.cn/lz/index , accessed on 25 September 2022) [22 (link)]. All other chemicals were purchased from Solarbio (Beijing, China) with the highest purity unless otherwise specified.
Pg kje8
Manufactured by Takara Bio
Sourced in China
The PG-KJE8 is a centrifuge rotor designed for use with Takara Bio's high-speed centrifuges. It is capable of accommodating 8 microtubes or sample containers with a maximum volume of 2 mL each. The rotor is constructed from durable materials to provide reliable and consistent performance during high-speed centrifugation.
Automatically generated - may contain errors
Lab products found in correlation
Pgro7, by Takara Bio (3 mentions)
Pg tf2, by Takara Bio (3 mentions)
Pkje7, by Takara Bio (2 mentions)
E coli shuffle t7, by New England Biolabs (2 mentions)
Fast mutagenesis system, by Transgene (1 mentions)
T4 dna ligase, by Transgene (1 mentions)
Easypfu dna polymerase, by Transgene (1 mentions)
Dna marker, by Transgene (1 mentions)
Gel band purification kit, by GE Healthcare (1 mentions)
Gfxtm pcr dna, by GE Healthcare (1 mentions)
Ptf16, by Takara Bio (1 mentions)
Hiload 16 60 superdex 200 column, by GE Healthcare (1 mentions)
Superose 6 increase 10 300, by GE Healthcare (1 mentions)
Superdex 200 16 60, by GE Healthcare (1 mentions)
Escherichia coli bl21 de3, by Takara Bio (1 mentions)
Ni nta agarose, by Qiagen (1 mentions)
9 protocols using pg kje8
1
Optimized Microcystis Genes in E. coli
2
Overexpression and Purification of SulN and SulP
3
Recombinant Protein Expression in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli DH5α and E. coli BL21(DE3), used for plasmid propagation and over-expression, respectively, were purchased from Novagen (Madison, WI, USA). pET24b(+) was obtained from Novagen (Madison, WI, USA) and was used as a cloning and expression vector. pET24bPsBFDC and pET19bPsBADH containing benzoylformate decarboxylase gene (dpgB) and benzaldehyde dehydrogenase gene (dpgC) of Pseudomonas stutzeri ST201, respectively, were obtained from our previous study [15 (link)], and also pEPL containing d -phenylglycine aminotransferase gene (dpgA) was obtained from our previous study [20 (link)]. Chaperone plasmids pG-KJE8, pGro7, pKJE7, pG-Tf2, and pTf16 were purchased from Takara Bio Inc. (Shiga, Japan). GFXTM PCR DNA and Gel Band Purification Kit were products of GE Healthcare Inc. (Buckinghamshire, UK). Different strains of E. coli were cultivated at 37 °C in Luria Bertani (LB) medium (Difco, Tucker, GA, USA).
4
Purification and Mutagenesis of M1.HpyAVI
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ORF encoding M1.HpyAVI was inserted into the expression plasmid pET22b (Novagen, Massachusetts, USA) to produce a recombinant protein containing a C-terminal His-tag. In order to produce soluble protein, a chaperone plasmid PG-KJE8 (TaKaRa, Dalian, China) was co-expressed with M1.HpyAVI. The recombinant protein was purified with a three-step chromatography protocol using a Ni-NTA affinity column, a HiLoad 16/60 Superdex 200 column and a mono-S HR 5/5 column (1ml) (GE Healthcare, Uppsala, Sweden). Mutants of M1.HpyAVI were generated using the Muta-direct Site-directed Mutagenesis kit (SBS Genetech, Beijing, China) and produced using the same protocol with wide type protein.
5
Purification of Atg Autophagy Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Atg32, Atg9, Atg17, Atg29 and Atg31 were expressed and purified as previously described [11 (link),32 (link),39 (link)]. Atg11 or its N-terminal fragment Atg11ΔC were coexpressed from pCoofy37-Atg11 or pCoofy37-Atg11ΔC vectors with chaperones from pG-KJE8 (Takara) in Escherichia coli BL21 (DE3). Expression was induced with 0.3 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG) for 18 h. Atg11 was purified by Ni-NTA-affinity chromatography followed by PreScission protease digestion and gel filtration (Superose6 Increase 10/300 (GE Healthcare) or Superdex200 16/60 columns). Protein aliquots were stored at −80 °C until use.
6
Heterologous Expression of Txtd and Txte
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli DH5α was used for molecular cloning and plasmid propagation. E. coli BL21 Star(DE3) was used for preparation of cell extracts. The genes of txtD (1203 bp) and txtE (1221 bp) were amplified by PCR from the genome of Streptomyces acidiscabies and cloned into the vector pJL1. The primers used for PCR amplification are shown in Table 1 . Plasmid pJL1-sfGFP was digested with NdeI and SalI to obtain a linearized backbone, which was ligated with the genes txtD and txtE, respectively, using a recombinant ligation kit (Beyotime, China). The resulting plasmids for cell-free expression were named as pJL1-TxtD and pJL1-TxtE. The plasmids of molecular chaperones (pG-KJE8, pGro7, and pG-Tf2) were obtained from TaKaRa (Beijing, China). pG-KJE8 (dnaK-dnaJ-grpE and groES-groEL), pGro7 (groES-groEL), and pG-Tf2 (groES-groEL-tig) were transformed into of E. coli BL21 Star(DE3), respectively, for the preparation of cell extracts containing chaperone proteins.Table 1
Primers used for PCR amplification.
| Genes | Primer sequences (5’→3′) |
|---|---|
| txtD | |
| Forward | catcatcatcaccatatgacctccgaagtcgctctgggccctt |
| Reverse | tgttagcagccggtcgacttactggtgggggtagaagttggggcgct |
| txtE | |
| Forward | catcatcatcaccatatgaccgtcccctcgccgctcgccga |
| Reverse | tgttagcagccggtcgacttagcggaggctgagcggcaggga |
7
Overexpression and Purification of SulN and SulP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the primers indicated (Supplementary Table 1 ), sulN and sulP were cloned from the sulfazecin gene cluster12 (link) by PCR amplification (Phusion high-fidelity DNA polymerase). The PCR products were ligated into pET29b and co-transformed along with the chaperone-bearing plasmid pG-KJE8 (Takara) into E. coli Shuffle T7 (NEB). A 50 mL overnight seed culture was used to inoculate 4 L TB medium in a bioreactor containing 50 μg/mL kanamycin, 50 μg/mL chloramphenicol, 5 ng/mL tetracycline, and 0.5 mg/mL L-arabinose. Overexpression was induced with 0.5 mM IPTG at OD600 = 0.6 after the culture was chilled on ice for 40 min. Cells were harvested after overexpression was carried out for 24 h at 15 °C. SulN and SulP were purified in a fashion similar to that used for PCP2, PCP3, PCP3-TE (Supplementary Figs. 12, 13, and 14 ).
8
Chaperone-Assisted Endolysin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid pG-KJE8 (TAKARA BIO INC) encoding chaperones (dnaK and groEL) and their co-factors (dnaJ-grpE-groES), was transformed into the expression strain E. coli C43 (DE3) harboring the chosen endolysin plasmid. Co-expression of chaperones was induced by L-arabinose (0.25 mg/mL) and Tetracycline (5 ng/mL) 1 h before IPTG addition. Once induced, cultures were grown with shaking for 20 h at 20 °C, harvested by centrifugation at 3500g for 5 min at 4 °C and the pellet was re-suspended in 1 mL of lysis buffer.
9
Optimized Soluble ZIN1 Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain adequate yields of soluble ZIN1 protein, we transformed the expression constructs into Escherichia coli BL21(DE3) along with plasmid pG-KJE8 (Takara Bio USA, Inc.) for inducible coexpression of five different chaperone proteins. For expression, bacterial cultures were grown overnight in a 37°C incubator shaker in LB broth containing 20 µg of chloramphenicol per milliliter and 50 µg of ampicillin per milliliter. The cells were subcultured at 1:100 in LB with the same antibiotics as well as 2 mg of L-arabinose per milliliter and 10 ng of tetracycline per milliliter to induce chaperone coexpression. When the cultures achieved OD 600 = 0.4, isopropyl-b-D-thiogalactoside was added to a final concentration of 0.1 mM and the cultures were incubated with shaking at 16°C for approximately 20 h. Cells were harvested by centrifugation at 2,500 × g for 10 min and pellets were stored at _ 20°C. Both ZIN1 and GUS were affinity-purified under native conditions using Ni-NTA agarose (Qiagen), according to manufacturer instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!