Ecodry premix random hexamers kit

Total RNA was extracted from 1 mm³ sections of kidney (UKMa K4D) or intestinal tissue samples (UKMa1) using the GenElute^™ Mammalian Total RNA Miniprep Kit (Sigma Aldrich, Steinheim, Germany). Total RNA was extracted from intestinal fluid for the French L232 rabbit using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany). The RNA to cDNA EcoDry™ Premix—Random Hexamers kit (Clontech, Saint-Germain-en-Laye, France)—was used for cDNA synthesis.

Samples from cultured cells and explanted xenografts were processed using the RNA II kit (Macherey-Nagel) according to the manufacturer's protocol. 1 to 5 μg total RNA were transcribed using the RNA to cDNA EcoDry Premix (Random Hexamers) kit (Clontech). qPCRs were run on a Roche LightCycler LC480, using the following program: 5 min pre-incubation at 95°C, 40 amplification cycles (10 sec 95°C, 10 sec 60°C, 10 sec 72°C) and melting curve. Obtained data was analyzed using the Biogazelle qbase+ software. Employed PCR primers were: HPRT1 (forward: CCTGGCGTCGTGATTAGTGAT; reverse: AGACGTTCAGTCCTGTCCATAA); ACTB (forward: CCTCGCCTTTGCCGATCCG; reverse: CCACC ATCACGCCCTGGTG); GAPDH (forward: GAAGGTG AAGTTCGGAGTC; reverse: GAAGATGGTGATGGG ATTTC); RNA18S5 (forward: GTTCCGACCATAAAC GATGC; reverse: TGGTGGTGCCCTTCCGTCAAT); TBP (forward: TTCGGAGAGTTCTGGGATTGT; reverse: TGGACTGTTCTTCACTCTTGG C); HMBS (forward: ATGTCTGGTAACGGCAATGC; reverse: CGTCTGTAT GCGAGCAAGC); URI1 (forward: AATGCCCTTCGA GAAAGACTCA; reverse: CCCCCAGTAAAACAGTG ACTTC); BBC3/Puma (forward: GACCTCAACGCAC AGTACGAG; reverse: AGGAGTCCCATGATGAGAT TGT); PMAIP1/Noxa (forward: GCAAGAACGCTCAA CCGAG; reverse: AAGTTTCTGCCGGAAGTTCA); CDKN1A (forward: AGTCAGTTCCTTGTGGAGCC; reverse: CATGGGTTCTGACGGACAT); MDM2 (forward: TGTTGTGAAAGAAGCAGTAGCA; reverse: CCTGATCCAACCAATCACCT).

Total RNA was extracted from approximately one cubic millimetre sections of liver (UKRn3, PLMg1) or intestinal tissue samples (UKMa1) using the GenElute™ Mammalian Total RNA Miniprep Kit (Sigma Aldrich, Steinheim, Germany). Total RNA was extracted from intestinal fluid for the France resident L232 rabbit CoV using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany). The RNA to cDNA EcoDry™ Premix - Random Hexamers kit (Clontech, Saint-Germain-en-Laye, France) was used for cDNA synthesis.