1 mm gap cuvette, by Bio-Rad - Product details

1

Bacterial Transformation via Electroporation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 3

1.5-2 μl of ligation mixture was transformed into 20 μl of ElectroMax DH10B T1 Phage-Resistant Competent Cells (Invitrogen, Cat #12033-015) by electroporation using MICROPULSER™ (BioRad) set at 1.7 kV using a 1 mm gap cuvette (BioRad, Cat #165-2089); after a pulse 1 ml SOC was added to cells and cells were incubated at 37° C. for 1 h with shaking at 200 rpm. 10 μl of recovery mixture was plated on LB agar plates containing ampicillin at a concentration of 100 μg/ml. Plates were incubated overnight at 37° C.

US10689656B2. Expression constructs and methods of genetically engineering methylotrophic yeast (2020-06-23). Impossible Foods Inc. [US]. Inventors: Smita Shankar [US], Martin Andrew Hoyt [US].

+ Open protocol

+ Expand

2

Generation of Zeb2 Enhancer Knockout Mice

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Enhancer deletion mice were generated as described (Durai et al., 2019 (link)). sgRNAs flanking the - 165-kb Zeb2 enhancer were identified using CHOPCHOP (http://chopchop.cbu.uib.no/), and the following sgRNA sequences were used: Zeb2 −165 5’: GAGTGAGAGATCATCAAATG and Zeb2 +165 3’: GATAACGTTCTTGAAGCATA. sgRNA with the desired sequences were synthesized and conjugated with purified Cas9 protein to form the RNP complex by the Department of Pathology Micro-Injection Core at Washington University in St Louis. Day 0.5 single cell zygotes from C57Bl/6 mice were isolated and underwent electroporation at the Department of Pathology Micro-Injection Core at Washington University in St Louis. Around 60 single cell zygotes were electroporated with 8μM of RNP complex using 1mm gap cuvette (BioRad). Electroporated zygotes were then transferred into the oviducts of pseudopregnant recipient mice.
The resulting pups were screened by PCR with the following primers to identify those that had successful deletion of the enhancers of interest: 165mutant-Screening-5’: CTGCAGCAGGTTGACAAAGA; 165mutant-Screening-3’: CCTGAAGTGTACGCTCACCA. Mice with the desired deletion were then outcrossed to wildtype (WT) C57BL6/J mice, and the resulting heterozygous mice were intercrossed to generate homozygous enhancer deletion mice.

Huang X., Ferris S.T., Kim S., Choudhary M.N., Belk J.A., Fan C., Qi Y., Sudan R., Xia Y., Desai P., Chen J., Ly N., Shi Q., Bagadia P., Liu T., Guilliams M., Egawa T., Colonna M., Diamond M.S., Murphy T.L., Satpathy A.T., Wang T, & Murphy K.M. (2021). Differential usage of transcriptional repressor Zeb2 enhancers, distinguishes adult and embryonic hematopoiesis.. Immunity, 54(7), 1417-1432.e7.

+ Open protocol

+ Expand

3

Bacterial Transformation via Electroporation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 3

1.5-2 μl of ligation mixture was transformed into 20 μl of ElectroMax DH10B T1 Phage-Resistant Competent Cells (Invitrogen, Cat #12033-015) by electroporation using MicroPulser (BioRad) set at 1.7 kV using a 1 mm gap cuvette (BioRad, Cat #165-2089); after a pulse 1 ml SOC was added to cells and cells were incubated at 37° C. for 1 h with shaking at 200 rpm. 10 μl of recovery mixture was plated on LB agar plates containing ampicillin at a concentration of 100 μg/ml. Plates were incubated overnight at 37° C.

US09938327B2. Expression constructs and methods of genetically engineering methylotrophic yeast (2018-04-10). Impossible Foods Inc. [US]. Inventors: Smita Shankar [US], Martin Andrew Hoyt [US].

+ Open protocol

+ Expand

4

Bacterial Transformation via Electroporation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 3

1.5-2 μl of ligation mixture was transformed into 20 μl of ElectroMax DH10B T1 Phage-Resistant Competent Cells (Invitrogen, Cat #12033-015) by electroporation using MicroPulser (BioRad) set at 1.7 kV using a 1 mm gap cuvette (BioRad, Cat #165-2089); after a pulse 1 ml SOC was added to cells and cells were incubated at 37° C. for 1 h with shaking at 200 rpm. 10 μl of recovery mixture was plated on LB agar plates containing ampicillin at a concentration of 100 μg/ml. Plates were incubated overnight at 37° C.

US10273492B2. Expression constructs and methods of genetically engineering methylotrophic yeast (2019-04-30). Impossible Foods Inc. [US]. Inventors: Smita Shankar [US], Martin Andrew Hoyt [US].

+ Open protocol

+ Expand

5

Bacterial Transformation via Electroporation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 3

1.5-2 μl of ligation mixture was transformed into 20 μl of ElectroMax DH10B T1 Phage-Resistant Competent Cells (Invitrogen, Cat #12033-015) by electroporation using MICROPULSER™ (BioRad) set at 1.7 kV using a 1 mm gap cuvette (BioRad, Cat #165-2089); after a pulse 1 ml SOC was added to cells and cells were incubated at 37° C. for 1 h with shaking at 200 rpm. 10 μl of recovery mixture was plated on LB agar plates containing ampicillin at a concentration of 100 μg/ml. Plates were incubated overnight at 37° C.

US11319544B2. Expression constructs and methods of genetically engineering methylotrophic yeast (2022-05-03). Impossible Foods Inc. [US]. Inventors: Smita Shankar [US], Martin Andrew Hoyt [US].

+ Open protocol

+ Expand

6

Generation of Gm39266 Mutant Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gm39266 mutant mice were generated as illustrated in Figures 3A and 4, A and D. gRNA 1 (CAGGCACAGTCTGGGTACAC), gRNA 2 (GGTAAGAAATCCTACCTCTG), and gRNA 3 (AGGTTCCATGTCCAGCACAT) were identified using Benchling (https://www.benchling.com/crispr). The ssODN donor sequence used in generating Gm39266 3× polyA knock-in (pA/pA) mice is shown in Supplemental Figure S2D. gRNAs with the desired sequence were ordered from IDT and were conjugated with purified Cas9 protein to form the RNP complex by the Genetic Editing and iPS Cell (GEiC) Center at Washington University in St. Louis. Day 0.5 single-cell zygotes were isolated, and CRISPR reagents were introduced via electroporation by the Department of Pathology/Immunology Transgenic Mouse Core at Washington University in St. Louis. Around 60 single-cell zygotes were electroporated with 8 μM RNP complex using a 1-mm gap cuvette (Bio-Rad). Electroporated zygotes were then transferred into the oviducts of day 0.5 pseudopregnant recipient mice.
The resulting pups were screened by PCR using the primers shown in Supplemental Figure S2, A–C, followed by Sanger sequencing to identify those that had successful deletions or insertions of interest. Mice with the desired mutation were then outcrossed to WT C57BL/6J mice, and the resulting heterozygous mice were intercrossed to generate homozygous Gm39266 mutant mice.

Liu T.T., Ou F., Belk J.A., Bagadia P., Anderson DA I.I.I., Durai V., Yao W., Satpathy A.T., Murphy T.L, & Murphy K.M. (2023). Cis interactions in the Irf8 locus regulate stage-dependent enhancer activation. Genes & Development, 37(7-8), 291-302.

+ Open protocol

+ Expand

7

Bacterial Cultivation and Transformation

Check if the same lab product or an alternative is used in the 5 most similar protocols

EcNR2 18 , EcHB3 (Supplementary Table S6), C2566 (New England BioLabs, USA), and their derivatives were grown at 30°C (37°C for C2566) in Luria-Bertani (LB) broth (or agar) supplemented with appropriate antibiotics: ampicillin, 50 μg/ml; kanamycin, 30 μg/ml; or spectinomycin, 100 μg/ml.
IPTG was added to a final concentration of 1 mM. Electroporation was performed as follows: cells were grown until reaching an OD 600 of 0.7. Next, cells equivalent to 1 ml of culture medium were washed twice with 1 ml of ddH2O and resuspended in 50 μl of the appropriate product. The cells were then pulsed with 1.8 kV in a 1-mm-gap cuvette (Bio-Rad, USA).

Lim H., Jun S., Park M., Lim J., Jeong J., Lee J.H., & Bang D. (2020). Multiplex generation, tracking, and functional screening of substitution mutants using a CRISPR/retron system.

+ Open protocol

+ Expand

8

Bacterial Cultivation and Transformation

Check if the same lab product or an alternative is used in the 5 most similar protocols

EcNR2 18 , EcHB3 (Supplementary Table S6), C2566 (New England BioLabs, USA), and their derivatives were grown at 30°C (37°C for C2566) in Luria-Bertani (LB) broth (or agar) supplemented with appropriate antibiotics: ampicillin, 50 μg/ml; kanamycin, 30 μg/ml; or spectinomycin, 100 μg/ml.
IPTG was added to a final concentration of 1 mM. Electroporation was performed as follows: cells were grown until reaching an OD 600 of 0.7. Next, cells equivalent to 1 ml of culture medium were washed twice with 1 ml of ddH2O and resuspended in 50 μl of the appropriate product. The cells were then pulsed with 1.8 kV in a 1-mm-gap cuvette (Bio-Rad, USA).

Lim H., Jun S., Park M., Lim J., Jeong J., Lee J.H, & Bang D. (2020). Multiplex Generation, Tracking, and Functional Screening of Substitution Mutants Using a CRISPR/Retron System. ACS synthetic biology, 9(5).

+ Open protocol

+ Expand

1 mm gap cuvette

Lab products found in correlation

8 protocols using 1 mm gap cuvette

Bacterial Transformation via Electroporation

Generation of Zeb2 Enhancer Knockout Mice

Bacterial Transformation via Electroporation

Bacterial Transformation via Electroporation

Bacterial Transformation via Electroporation

Generation of Gm39266 Mutant Mice

Bacterial Cultivation and Transformation

Bacterial Cultivation and Transformation

About PubCompare

Ready to get started?