Total RNA was extracted from cells as the manufacture of TRIzol reagent (10296010, Thermo Fisher Scientific (Waltham, MA, USA)) indicated. RNAs were reversely transcribed into cDNA using PrimeScript™ RT Master Mix (RR036A, Takara Bio Inc. (Japan)). qRT-PCR assay was conducted using SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) (RR820Q, Takara Bio Inc.(Japan)) on a QuantStudio™ 7 Flex Real-Time PCR System platform (Thermo Fisher Scientific (Waltham, MA, USA)) following standard protocols. The expression of β-actin was set as endogenous control and the expressions of genes were calibrated to that of corresponding control cells. Data analyses were conducted by QuantStudio Real-Time PCR Software. RQ values (relative quantified value of mRNA expression) were calculated by the same software followed by two-tailed Student’s t test to determine significant differences between two groups. P < 0.05 was considered statistically significant. All the primers designed for qRT-PCR are in Additional file 1 : Table S1.
Quantstudio 7 flex real time pcr system platform
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan
The QuantStudio™ 7 Flex Real-Time PCR System is a high-performance real-time PCR platform. It is designed for flexible, high-throughput gene expression, genotyping, and copy number variation analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Sybr premix ex taq 2 tli rnaseh plus, by Takara Bio (2 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Sybr green supermix, by Takara Bio (2 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
Power sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Primer express version 2, by Thermo Fisher Scientific (1 mentions)
10 protocols using quantstudio 7 flex real time pcr system platform
1
Quantitative Real-Time PCR Analysis
2
Colorectal Cancer Tissue Preservation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 62 primary CRC patients who received radical colorectal surgery at FUSCC between 2008 and 2009 were included in this study. The Ethical Committee of FUSCC reviewed and approved this study design. All eligible patients signed written informed consent. The enrollment criteria included (a) pathologically confirmed primary CRC and no history of other cancers; (b) planned curative surgical resection; and (c) complete clinical and follow-up data. Depending on the follow-up system of FUSCC, the clinical statistics center of the hospital provided survival data. Once separated, the resected specimens were immediately put into liquid nitrogen and transferred to −80 °C for preservation. The total RNA was isolated by using TRIzol reagent (10296010, Thermo Fisher Scientific (Waltham, MA, USA)), according to the manufacturer’s instructions. SYBR Green Supermix (Takara) was used to perform real-time polymerase chain reaction (PCR) on a QuantStudio™ 7 Flex Real-Time PCR System platform (Thermo Fisher Scientific (Waltham, MA, USA)) following standard protocols.
3
Chromatin Immunoprecipitation (ChIP) Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1 × 107 cells were fixed by adding formaldehyde to a final concentration of 1% and rotated gently at room temperature (RT) for 10 min. Glycine was added to a final concentration of 125 mM and incubated with shaking for 5 min at RT. After three washes with cold PBS, the cells were pelleted at 500 G for 5 min at 4°C and resuspended in 1.5 ml of L1 Lysis buffer (50 mM Tris pH 8, 2 mM EDTA pH 8, 0.1% Igepal-Ca 630, 10% glycerol, protease inhibitors). Samples were incubated on ice for 5 min and centrifuged at 800 G for 5 min at 4°C. Nuclei were resuspended in 1.5 ml L2 Lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris pH 8, protease inhibitors) and sonicated to shear the DNA to fragment lengths of 200–500 bp. ChIPs were performed overnight using protein A/G beads and antibodies specific for SMARCA4 (ab265605), SMARCC1 (ab126180) or Histone H3 (ab1791). 5 µg of antibody was used for each immunoprecipitation. A no-antibody control was included for each immunoprecipitation and input samples were processed in parallel. After elution and reversal of cross-links, DNA was purified with phenol:chloroform extraction. qPCR was carried out in triplicate using Power SYBR Green PCR Master Mix in QuantStudio™ 7 Flex Real-Time PCR System platform (Thermo Fisher Scientific). Three independent experiments were performed for each ChIP.
4
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells with TRIzol reagent (10296010, Thermo Fisher Scientific, Waltham, MA). PrimeScript RT Master Mix (RR036A, Takara, Tokyo, Japan) was applied for reverse transcription, and 2-μg RNA was reverse transcribed into cDNA according to the manufacturer's instructions. Real-time PCR analysis of gene expression was conducted with SYBR Premix Ex Taq II (Tli RNaseH Plus; RR820Q, Takara, Tokyo, Japan) on a QuantStudio7 Flex Real-Time PCR System platform (Thermo Fisher Scientific) following the manufacturer's instructions. Gene expression was normalized to β-actin, a reference gene, and data were analyzed with QuantStudio Real-Time PCR Software (three biological and technical replicates for each sample). Data are presented as the fold change calculated by the 2−ΔΔCt method. The primers used for qPCR are listed in Supplementary Table S3.
5
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated by using TRIzol reagent (10296010, Thermo Fisher Scientific (Waltham, MA, USA)), according to the manufacturer’s instructions. SYBR Green Supermix (Takara) was used to perform real-time polymerase chain reaction (PCR) on a QuantStudio™ 7 Flex Real-Time PCR System platform (Thermo Fisher Scientific (Waltham, MA, USA)) following standard protocols. The expression of β-actin was set as an endogenous control, and the expression of genes was calibrated to that of the corresponding control cells. Data analyses were conducted by QuantStudio Real-Time PCR Software. RQ values (relative quantified value of mRNA expression) were calculated by the same software and analyzed by two-tailed Student’s t test to determine significant differences between two groups. All primers designed for qRT-PCR are listed in Supplementary Table 1 .
6
SARS-CoV-2 Detection in Fecal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction from fecal, human, and mouse samples was adapted from a previously published protocol.72 (link) Briefly, fecal samples were diluted 1:5 (w:v) in guanidine, homogenized, and clarified by centrifugation (4,000xg, 20 min, 4°C). Viral RNA was purified using the QIAamp Viral RNA Mini Kit, following the manufacturer’s instructions. RT-qPCR for SARS-CoV-2 was performed using the one-step RT-qPCR Master Mix according to the CDC USA protocol (CDC, 2020), and primers for N1 and N2 (cat. no. 10006770) on a QuantStudio™ 7 Flex Real-Time PCR System platform (Applied Biosystems, USA). For analysis, amplification values of N1 or N2 viral targets with threshold cycle (Ct) below 40.0 were considered positive for SARS-CoV-2, and above 40 or indeterminate were considered undetectable, and the relative concentrations were expressed in arbitrary units. Fecal samples spiked with inactivated SARS-CoV-2 (stock titer 6.7 × 106 PFU/mL) were used as a positive control at different dilutions.
7
Quantifying Age-Dependent Changes in REST/SNAP25 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from cortical samples of mice at 6 and 12 months of age was isolated using TRIzol reagent as per manufacturer’s instructions (Thermo Scientific). RNA was resuspended in of nuclease-free water, and its concentration was analyzed by spectrophotometer (NanoDrop™, Thermo Scientific). cDNAs were prepared from 2 μg of total RNA extracted and RT-qPCR was performed from 10 × diluted cDNA using Power SYBR Green PCR Master Mix in the QuantStudio7 Flex real-time PCR system platform (Applied Biosystems). mRNA levels of REST/NRSF and SNAP25 were quantified using the following primers: REST (forward: 5′-CATGCTGATTAGAGGCCACA-3′; reverse: 5′GTGCGAACTCACACAGGAGA -3′); SNAP25 (forward: 5′ GCCTTCTCCATGATCCTGTC − 3′; reverse: 5′- CTTCATCCGCAGGGTAACAA-3′). Changes in gene expression were determined with the 2−ΔΔCt method using actin as a housekeeping gene.
8
Microbial Enrichment Efficacy Measurement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the efficacy of the microbial enrichment step, three independent methods were used. First, we used a qPCR-based quantification of the bacterial 16 S rRNA gene, relative to the copy number of the human β-actin gene present in biopsy DNA before and after microbial enrichment, as described by Shanahan et al. [22 (link)]. The qPCR was performed using the QuantStudio™ 7 Flex Real-Time PCR System platform (Applied Biosystems, CA, USA), with the Power SYBR Green Master Mix (Life Technologies, UK). Next, we used two different bioinformatics approaches to quantify enrichment. An initial assessment of the raw, unfiltered sequences was performed using GraftM [23 (link)] to provide an absolute count on the number of reads assigned to bacterial/archaeal 16 S rRNA genes. Subsequently, we also used MetaPhlAn2 [24 (link)] with the quality-filtered MGS data (as described below) to again provide an absolute count of those reads assigned to specific microbial marker genes present in the different MGS datasets.
9
RT-qPCR Analysis of Hippocampal Gene Expression in Post-COVID Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the hippocampus of post-COVID HM mice and controls was extracted using TRIzol reagent (Thermo Scientific, USA). cDNAs was synthesized and subjected to qPCR using Power SYBR Green Master Mix kits following the manufacturer’s instructions on the QuantStudio™ 7 Flex real-time PCR system platform (Applied Biosystems, USA). Primer sequences used are listed in Table 3 . Gene expression changes were determined by the 2–ΔCt method using ribosomal protein L32 for normalization.
Primer sequences for RT-qPCR.
| Gene Name | Forward primer (5’-3’) | Reverse primer (5’-3’) |
|---|---|---|
| IL-1β | TTGACGGACCCCAAAAGAT | GAAGCTGGATGCTCTCATCTG |
| IL6 | GATGGATGCTACCAAACTGGA | CCAGGTAGCTATGGTACTCCAGAA |
| TNF1 | TGCTGGGAAGCCTAAAAGG | CGAATTTTGAGAAGATGATCCTG |
| TNF2 (link) | GCTGAGCTCAAACCCTGGTA | CGGACTCCGCAAAGTCTAAG |
| IFNβ | GCCCTGTAGGTGAGGTTGATCT | AGCTCCAAGAAAGGACGAACAT |
| PSD-95–Dgl4 | TCTGTGCGAGAGGTAGCAGA | AAGCACTCCGTGAACTCCTG |
| BDNF | ATGAAAGAAGTAAACGTCCAC | CCAGCAGAAAGAGTAGAGGAG |
| RpL32 | GCTGCCATCTGTTTTACGG | TGACTGGTGCCTGATGAACT |
| MHV-3 | CAGATCCTTGATGATGGCGTAGT | AGAGTGTCCTATCCCGACTTTCTC |
1 Primer used for RT-PCR in lung and gut samples; 2 (link)Primer used for RT-PCR in brain samples; IL, interleukin; TNF, Tumor necrosis factor; IFN, interferon; PSD-95–Dgl4, Post-synaptic density protein; BDNF, Brain-derived neurotrophic factor; RpL, Ribosomal protein; MHV-3, Murine Hepatitis Virus-3 nucleocapsid protein (N) gene.
10
Gene Expression Analysis by Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted, and cDNA was synthesized by reverse transcription as previously described [40 (link)]. The expression of selected genes was quantified by real-time PCR using a Quant Studio7 Flex Real-Time PCR System platform (Applied Biosystems Inc, Milan, Italy). Gene-specific primers were designed using Primer Express version 2.0 software (Applied Biosystems Inc, Milan, Italy). For GPER and actin, whose genes were used as controls to obtain normalized values, the primers were 5’-ACACACCTGGGTGGACACAA-3’ (GPER forward) and 5’-GGAGCCAGAAGCCACATCTG-3’ (GPER reverse) as well as 5′-AAGCCACCCCACTTCTCTCTAA-3′ (actin forward) and 5′-CACCTCCCCTGTGTGGACTT-3′ (actin reverse), respectively. The assays were performed in triplicate and the results were normalized for actin expression and then calculated as fold induction of RNA expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!