Reverse transcriptionmaster mix

Manufactured by Takara Bio

Sourced in Japan

Reverse transcription master mix is a ready-to-use solution containing the necessary components for efficient reverse transcription of RNA into cDNA. It includes a reverse transcriptase enzyme, dNTPs, and buffer system, streamlining the reverse transcription process.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (2 mentions) Rna isolation kit, by Takara Bio (1 mentions) Abi prism 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions) Applied biosystems veriti 96 well thermal cycler, by Thermo Fisher Scientific (1 mentions) Depc treated water, by Thermo Fisher Scientific (1 mentions) Nanodrop 2000 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions) Ssoadvanced universal sybr green supermix, by Bio-Rad (1 mentions) Cfx96 touch real time pcr system, by Bio-Rad (1 mentions) Thermocycler, by Bio-Rad (1 mentions) Sybr premix ex taqtm 2, by Takara Bio (1 mentions) Trizol reagent, by Merck Group (1 mentions) Taq dna polymerase, by Takara Bio (1 mentions)

5 protocols using reverse transcriptionmaster mix

Chondrogenic Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For evaluating
the expression of chondrogenic marker genes, RNA was isolated from
the retrieved cartilage tissue using an RNA isolation kit (Takara).
Isolated RNA was reverse transcribed to cDNA by a reverse transcription
master mix (iNtRON). RT-PCR and real-time PCR analyses were performed
to confirm the expression of chondrogenic marker genes. For RT-PCR
analysis, COL2 expression was evaluated by comparing it with the expression
of a housekeeping gene (GAPDH) using conventional agarose gel electrophoresis.
The primer sequences were as follows: GAPDH, 5′-TCACCATCTTCCAGGAGCGA-3′,
and 5′-CACAATGCCGAAGTGGTCGT-3′; COL2, 5′-CAATCCTGGTGAACCTGGCG-3′, and 5′-TTTCCCCAGACTTTCCGGGC-3′.
Moreover, mRNA expression was quantified using a SYBR Green PCR
kit in an ABI PRISM 7500 real-time PCR system (Applied Biosystems).
Gene expression was determined by comparing it with the expression
of a housekeeping gene (β-actin). The primer sequences for real-time
PCR were as follows: β-actin, 5′-CCCTGAACCCTAAGGCCAAC-3′,
and 5′-GCATACAGGGACAGCACAGC-3′; COL2, 5′-CACACTGGTAAGTGGGGCAAGACCG-3′, and 5-GGATTGTGTTGTTTCAGGGTTCGGG-3′.

Lee H.J., Seo Y., Kim H.S., Lee J.W, & Lee K.Y. (2020). Regulation of the Viscoelastic Properties of Hyaluronate–Alginate Hybrid Hydrogel as an Injectable for Chondrocyte Delivery. ACS Omega, 5(25), 15567-15575.

+ Open protocol

+ Expand

Quantifying RAD51 Expression in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Parental and stably transfected cells were washed with ice-cold phosphate-buffered saline (PBS). RNA was extracted using TRIzol^® reagent (Thermo Fisher Scientific) according to the manufacturer’s protocol. The RNA samples were dried and eluted in 10–30 µL of diethyl pyrocarbonate (DEPC)-treated water (Thermo Fisher Scientific). All preparative and handling procedures were performed under RNase-free conditions. The RNA concentration was measured using a Nanodrop™ 2000/2000c spectrophotometer (Thermo Fisher Scientific), and the total RNA samples were stored at −70 °C.
cDNA was synthesized using reverse transcription master mix (TaKaRa, Koyto, Japan; RR036A). PCR cycle, consisting of 37 °C for 15 min and 85 °C for 5 s, was performed using an Applied Biosystems Veriti^® 96-Well Thermal Cycler (Thermo Fisher Scientific). SsoAdvanced™ Universal SYBR^® Green Supermix (Bio-Rad, Hercules, CA, USA) was used for RT-PCR, and the level of RAD51 was compared following treatment with various drugs. GAPDH served as a control. PCR cycles consisted of 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s and were performed using a CFX96 Touch Real-Time PCR System (Bio-Rad). Following primers were used to qRT-PCR: GAPDH, Forward—CGACCACTTTGTCAAGCTCA; Reverse—AGGGGAGATTCAGTGTGGTG and RAD51, Forward—AGCTTTCAGCCAGGCAAAT; Reverse—GCTTCAGCTTCAGGAAGACA.

Lee J.D., Ryu W.J., Han H.J., Kim T.Y., Kim M.H, & Sohn J. (2022). Molecular Characterization of BRCA1 c.5339T>C Missense Mutation in DNA Damage Response of Triple-Negative Breast Cancer. Cancers, 14(10), 2405.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from mouse brains and cells using TRIzol reagent (Sigma Aldrich, USA). The RNA concentration was quantified using spectrophotometry (Thermo Fisher Scientific, Waltham, USA). Reverse Transcription Master Mix (Takara, Tokyo, Japan) was used to synthesize cDNA by reverse transcription at 42 ℃ for 15 min followed by a denaturation step at 85 ℃ for 5 s. mRNA expression was analyzed using SYBR Premix Ex Taq TM II (Takara, Tokyo, Japan) and synthetic primers on a thermocycler (Bio-Rad, Hercules, California, USA). Relative mRNA expression levels were calculated and quantified with the 2 -ΔΔCt method after normalization to reference GAPDH expression [44] . The primers used for quantitative real-time PCR in this study are listed in Table 1.

Luo Y., Cheng J., Fu Y., Zhang M., Gou M., Li J., Li X., Bai J., Zhou Y., Zhang L, & Gao D. (2023). D-allose Inhibits TLR4/PI3K/AKT Signaling to Attenuate Neuroinflammation and Neuronal Apoptosis by Inhibiting Gal-3 Following Ischemic Stroke. Biological procedures online, 25(1).

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation was performed using the RNA Purification Kit (Yi Shan Biotechnology Company, Shanghai, China). cDNA was prepared by using the 5 × Reverse Transcription Master Mix (Takara, Osaka, Japan) and was performed according to the manufacturer’s protocol. Primers used in these experiments were as follows: β-actin, forward 5′-CATTGCCGACAGGATGCAG-3′, reverse 5′-CTCGTCATACTCCTGCTTGCTG-3′; P21, forward 5′-CATGTGGACCTGTCACTGTCTTGTA-3′, reverse 5′-GAAGATCAGCCGGCGTTG-3′; P27, forward 5′-CAATGCCGGTTCTGTGGAG-3′, reverse 5′-TCCATTCCATGAAGTCAGCGATA-3′. After reverse transcription, the cDNA product was amplified by PCR according to the manufacturer’s protocol (Takara, Osaka, Japan) and gene expression was quantified according to the 2^−ΔCt method.

Lv M., Zhuang X., Zhang Q., Cheng Y., Wu D., Wang X, & Qiao T. (2020). Acetyl-11-keto-β-boswellic acid enhances the cisplatin sensitivity of non-small cell lung cancer cells through cell cycle arrest, apoptosis induction, and autophagy suppression via p21-dependent signaling pathway. Cell Biology and Toxicology, 37(2), 209-228.

+ Open protocol

+ Expand

RNA Isolation, cDNA Synthesis, and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation was performed using the RNA Purification Kit (Yi Shan Biotechnology Company, Shanghai, China). cDNA was prepared using the 5× Reverse Transcription Master Mix (Takara, Osaka, Japan) and was performed according to the manufacturer’s protocol. Primers used in these experiments were as follows: β-Actin, forward 5ʹ-CATTGCCGACAGGATGCAG-3ʹ, reverse 5ʹ-CTCGTCATACTCCTGCTTGCTG-3ʹ; P21, forward 5ʹ-CATGTGGACCTGTCACTGTCTTGTA-3ʹ, reverse 5ʹ-GAAGATCAGCCGGCGTTG-3ʹ; P27, forward 5ʹ-CAATGCCGGTTCTGTGGAG-3ʹ, reverse 5ʹ-TCCATTCCATGAAGTCAGCGATA-3ʹ. After reverse transcription, the cDNA product was amplified by PCR with Taq DNA polymerase (Takara, Osaka, Japan).

Lv M., Shao S., Zhang Q., Zhuang X, & Qiao T. (2020). Acetyl-11-Keto-β-Boswellic Acid Exerts the Anti-Cancer Effects via Cell Cycle Arrest, Apoptosis Induction and Autophagy Suppression in Non-Small Cell Lung Cancer Cells. OncoTargets and therapy, 13, 733-744.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!