For generation of a lentiviral VDR expression vector, the PCR primers 5′-ctagtgaattcggtaccgaggagatctgccgc-3′ and 5′-tcgcgggatcccgtttaaaccttatcgtcgtc-3′ were used in a PCR with pCMV6-VDR used as a template. The PCR product was subcloned into the EcoRI and BamH1 sites of a pLVX-Puro vector, and the resultant vector was used to package lentiviral particles using the Lenti-X HT packaging system (Clontech Laboratories, Mountain View, CA). All vector constructs were confirmed using DNA sequence analysis. For generation of stable cell lines, 5×105 PANC-1 or mPanc96 cells were incubated for 5 hours with 1×106 particles of either L-EGFP or L-VDR in 2 mL of complete DMEM in the presence of polybrene (4 μg/mL).16 (link),42 (link) Cells infected with the lentivirus were subjected to selection in 5 μg/mL puromycin for 10 days before use.
Lenti x ht packaging system
Manufactured by Takara Bio
The Lenti-X HT Packaging System is a lentiviral packaging system designed for the production of high-titer lentiviral particles. The system includes a set of plasmids that encode the necessary viral components required for the production of lentiviral particles in mammalian cells.
Automatically generated - may contain errors
Lab products found in correlation
Lenti x gostix, by Takara Bio (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Plvx puro backbone, by Takara Bio (1 mentions)
Pmirglo dual luciferase vector, by Promega (1 mentions)
Doxycycline, by Merck Group (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Rnaimax, by Thermo Fisher Scientific (1 mentions)
Plvx puro, by Takara Bio (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Lenti x p24 rapid titer kit, by Takara Bio (1 mentions)
Plvx tight puro vector, by Takara Bio (1 mentions)
Plvx puro vector, by Takara Bio (1 mentions)
Puromycin, by Merck Group (1 mentions)
6 protocols using lenti x ht packaging system
1
Generating Lentiviral VDR Expression Vector
2
Lentiviral Vector and Luciferase Reporter Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For construction of lentiviral short hairpin RNA vector, each short hairpin RNA was prepared by 2 primers annealed and cloned into a pLVX‐Puro backbone (Clontech, Mountain View, CA; refer to Kang et al37 ). For construction of luciferase vectors, a 3′‐untranslated region (UTR) fragment of protein tyrosine phosphate, reporter type, D (PTPRD), HDAC4, and wingless‐type MMTV integration site family member 3A (WNT3A) was amplified from human genomic DNA and cloned into pmirGLO dual‐luciferase vector (Promega, Madison, WI). For corresponding mutational 3′‐UTR reporter vectors, the region that base paired with miR‐1281 seeding sequences was mutated by site‐directed mutagenesis. Sequences of primers used for vector construction are summarized in Table S2 . All constructs were confirmed by DNA sequencing.
Transfection of DNA plasmids into 293T or 293A cells was performed with polyethylenimine (Geneups, China), as previously reported.44 High‐titer lentivirus was generated through a Lenti‐X HT packaging system in 293T cells, according to manufacturer's instruction (Clontech, Mountain View, CA).
Transfection of DNA plasmids into 293T or 293A cells was performed with polyethylenimine (Geneups, China), as previously reported.
3
DGCR5 Overexpression in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full‐length DGCR5 cDNA was amplified from cDNA of BEAS‐2B and cloned into pLVX‐Puro plasmid. The lentivirus particles were packaged in 293T cell with Lenti‐X™ HT Packaging System (Clontech). The lentivirus was harvested and then infected A549 cells. The A549 cells with successful transfection of pLVX‐Puro‐DGCR5 or empty vector were screened using puromycin. The stably overexpressed DGCR5 in A549 cells were adopted in nude mice.
4
CRISPR-Cas9 Knockout of TP53, DDX11, and ESCO2 in RPE1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RPE1-hTERT cells (American tissue collection) and SV40 transformed fibroblasts, including WABS [28 (link)], RBS [36 (link)] and LN9SV control [71 (link)], were cultured in Dulbecco’s Modified Eagles Medium (DMEM, Gibco), supplemented with 10% FCS, 1 mM sodium pyruvate and antibiotics.
CRISPR-Cas9 was used to construct DDX11 and ESCO2 knockouts in RPE1 cells. The generation of RPE1-hTERT_TetOn-Cas9_TP53KO cells is also described in a currently submitted manuscript [68 ]. Briefly, Cas9 cDNA was cloned into the pLVX-Tre3G plasmid (Clontech) and lentiviral Tre3G-Cas9 and Tet3G particles were produced in HEK293T cells using the Lenti-X HT packaging system (Clontech). Transduced cells were selected with 10 μg/mL puromycin and 400 μg/mL G418. Cells were treated with 100 ng/mL doxycycline (Sigma-Aldrich) to induce Cas9 expression and transfected with 10 nM synthetic crRNA and tracrRNA (Dharmacon or IDT) using RNAiMAX (Invitrogen). The following crRNA sequences were used: TP53 (CCATTGTTCAATATCGTCCG ), DDX11-specific (GGCTGGTCTCCCTTGGCTCC ), ESCO2 (TAAGTGGTACCTCAATCCAC ). Single clones were assessed by Sanger sequencing using the following primers: TP53-Fw (GAGACCTGTGGGAAGCGAAA , TP53-Rv GCTGCCCTGGTAGGTTTTCT ), DDX11-Fw (AACAACCCACCCTCCCCAAG ), DDX11-Rv (TGCCTCACTCTCTCCAGACC ), ESCO2-Fw (ATCAAAAAGGTAGAAGATGTCCAAGAAC ), ESCO2-Rv (GCCTGTTTGATGGGTTCTGC ).
CRISPR-Cas9 was used to construct DDX11 and ESCO2 knockouts in RPE1 cells. The generation of RPE1-hTERT_TetOn-Cas9_TP53KO cells is also described in a currently submitted manuscript [68 ]. Briefly, Cas9 cDNA was cloned into the pLVX-Tre3G plasmid (Clontech) and lentiviral Tre3G-Cas9 and Tet3G particles were produced in HEK293T cells using the Lenti-X HT packaging system (Clontech). Transduced cells were selected with 10 μg/mL puromycin and 400 μg/mL G418. Cells were treated with 100 ng/mL doxycycline (Sigma-Aldrich) to induce Cas9 expression and transfected with 10 nM synthetic crRNA and tracrRNA (Dharmacon or IDT) using RNAiMAX (Invitrogen). The following crRNA sequences were used: TP53 (
5
Lentiviral Transduction of Mammalian Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral particles were produced using Lenti-X 293T cells. Briefly, 3x106 Lenti-X-293T cells were seeded one day before transfection. For the transfection assays, Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used according to the manufacturer's protocol and utilizing a mix of Lenti-X HT packaging systems (4 µg) and 1 µg of one of the following lentiviral vectors, pLVX-Puro (Takara Bio, Inc.) or the pLVX-EF1alpha-SARS-CoV-2-ORF3a-2xStrep-IRES-Puro vector (cat no. 141383; Addgene, Inc.) (43 (link)). After 48 h, to eliminate detached cells and cell detritus, the medium containing the viral particles was filtered through a 0.45-µm polyethersulfone membrane (Merck KGaA). The titer of viral particles was tested using Lenti-X GoStix (Takara Bio, Inc.). The medium containing the viral particles was aliquoted and stored at -80˚C until use. For the transduction assays, 1x106 target cells were seeded one day before transduction. The target cells were transduced with 200 µl medium containing lentiviral particles (~1x106 Inclusion-Forming Units). To obtain stable cell lines, after 72 h of transduction, the cells were incubated with 0.5 µg/ml puromycin for 3 weeks. The medium containing puromycin was replaced every three days; stable cells were cultured under normal conditions without puromycin. Cells were always cultivated or treated at 37˚C in a 5% CO2 atmosphere.
6
Lentiviral Transduction of HOXA9 ORF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The commercial HOXA9 Open Reading Frame (ORF) (cDNA clone MGC: 19648; Thermo Fisher Scientific, Inc. ) was subcloned into the pLVX-tight-Puro vector, a tetracycline-inducible expression system, and into the pLVX-Puro vector, a constitutive expression system (Takara Bio, Inc., Kusatsu, Shiga, Japan). Lentiviral particles were produced by transfecting Lenti-X™ 293T cells with Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) and Lenti-X™ HT Packaging Systems (Takara Bio, Inc.), according to the manufacturer's instructions. Lentiviral production was checked with Lenti-X™ GoStix™ (Takara Bio, Inc.) and the titer was determined by Enzyme-Linked ImmunoSorbent Assays (ELISA) with the Lenti-X™ p24 Rapid Titer Kit (Takara Bio, Inc.), according to the supplier's instructions. Then, 4 x 10 5 cells were transduced with at least 5 x 10 5 IFU viral particles. Positive selection was performed by adding G418 to final concentration of 500 µg/ml (Takara Bio, Inc.) or Puromycin to a final concentration of 1µg/ml (Sigma-Aldrich Quimica S. de R.L. de C.V.).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!