Cells were fixed with 4% paraformaldehyde at room temperature for 30 min and washed twice with PBS. After permeabilization with 0.5% Triton X-100 and blocking with 1% bovine serum albumin in PBS for 1 h, the cells were incubated with mouse anti-Bcl-2 and anti-Bax monoclonal antibodies (1∶100, Santa Cruz Biotechnology Inc., CA, USA) overnight at 4°C, followed by incubation with Cy3-labeled goat anti-mouse IgG (H+L) (Beyotime Institution of Biotechnology, Haimen, China) for 2 h at 37°C. The cells were then incubated with Hoechst 33342 for 10 min and examined under a fluorescence microscope (488 nm filter; OLYMPUS BX51, Japan).
Cy3 labeled goat anti mouse igg h l
Manufactured by Beyotime
Sourced in China
Cy3-labeled goat anti-mouse IgG (H + L) is a secondary antibody conjugated with the fluorescent dye Cy3. It is designed to detect and visualize mouse immunoglobulin G (IgG) in various immunological applications.
Automatically generated - may contain errors
Lab products found in correlation
Alexa fluor 488 labeled goat anti rabbit igg h l, by Beyotime (5 mentions)
4 6 diamidino 2 phenylindole (dapi), by Beyotime (4 mentions)
4 6 diamidino 2 phenylindole (dapi), by Solarbio (3 mentions)
A0521, by Beyotime (2 mentions)
Hoechst 33342, by Thermo Fisher Scientific (2 mentions)
Lsm 880, by Zeiss (2 mentions)
Hoechst, by Beyotime (1 mentions)
Anti col1a1, by Proteintech (1 mentions)
Anti lamin a c, by Cell Signaling Technology (1 mentions)
Anti lc3b, by Abcam (1 mentions)
Anti sirt1, by Abcam (1 mentions)
Anti vwf, by Santa Cruz Biotechnology (1 mentions)
Mcdb131, by Thermo Fisher Scientific (1 mentions)
Fitc labeled goat anti rabbit igg h l, by Beyotime (1 mentions)
Anti lamin b1, by Proteintech (1 mentions)
Anti acetyl lysine, by Abcam (1 mentions)
Hrp conjugated affinipure goat anti rabbit igg h l, by Proteintech (1 mentions)
Anti progerin, by Santa Cruz Biotechnology (1 mentions)
Rapamycin sirolimus, by Merck Group (1 mentions)
3 methyladenine 3 ma, by Merck Group (1 mentions)
21 protocols using cy3 labeled goat anti mouse igg h l
1
Immunofluorescence Assay for Bcl-2 and Bax
2
Immunofluorescence Staining of Transfected Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the transfected cells (1 × 105 cells/well) were plated on sterile glass coverslips in 24-well plates. The next day, all the cells were fixed, permeabilized and blocked. Subsequently, the cells were stained overnight with primary fluorescent antibodies to KMT2D (Atlas Antibodies, HPA035977), H3K4me1, WDR5, EpCAM and CDH2. Then, the cells were incubated with secondary fluorescent antibodies, 488-labeled goat anti-rabbit IgG (H + L) (Beyotime), Cy3-labeled goat anti-mouse IgG (H + L) (Beyotime), and Hoechst (Beyotime, 5 µg/mL).
3
Cellular Senescence and Oxidative Stress Modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The primary antibodies included anti-vWF (Santa Cruz, #sc-365712), anti-COL 1A1 (Proteintech, #14695-1-AP), anti-progerin (Santa Cruz, #sc-81611), anti-Lamin A/C (Cell Signaling Technology, #4777S), anti-Lamin B1 (Proteintech, #66095-1-Ig), anti-SIRT1 (Abcam, #ab110304), anti-LC3B (Abcam, #ab48394), anti-acetyl Lysine (Abcam, #ab22550), anti-Caveolin-1 (Cav-1) (Abcam, #ab32577), anti-Histone H3 (Proteintech, #17168-1-AP), and anti-GAPDH (Proteintech, #60004-1). The secondary antibodies included Cy3-labeled goat anti-mouse IgG (H+L) (Beyotime, #a0521), FITC-labeled goat anti-rabbit IgG (H+L) (Beyotime, #a0562), HRP-conjugated Affinipure Goat Anti-Mouse IgG(H+L) (Proteintech, #SA00001-1), and HRP-conjugated Affinipure Goat Anti-Rabbit IgG(H+L) (Proteintech, #SA00001-2).
The reagents used included carbon tetrachloride (CCl4) (Sigma-Aldrich, #56-23-5), hydrogen peroxide (H2O2) (Sigma-Aldrich, #1.07298), N-Acetylcysteine (NAC) (MedChemExpress, #616-91-1), mitochondria 2,2,6,6-tetramethylpiperidinooxy (mito-TEMPO) (MedChemExpress, #1334850-99-5), 3-Methyladenine (3-MA) (Sigma-Aldrich, #S2767), rapamycin (sirolimus) (Sigma-Aldrich, #S1039), MCDB131 (Gibco, #10372019), 1640 (Gibco, #11875101), and fetal bovine serum (FBS) (Biological Industries, #04-007-1A).
The reagents used included carbon tetrachloride (CCl4) (Sigma-Aldrich, #56-23-5), hydrogen peroxide (H2O2) (Sigma-Aldrich, #1.07298), N-Acetylcysteine (NAC) (MedChemExpress, #616-91-1), mitochondria 2,2,6,6-tetramethylpiperidinooxy (mito-TEMPO) (MedChemExpress, #1334850-99-5), 3-Methyladenine (3-MA) (Sigma-Aldrich, #S2767), rapamycin (sirolimus) (Sigma-Aldrich, #S1039), MCDB131 (Gibco, #10372019), 1640 (Gibco, #11875101), and fetal bovine serum (FBS) (Biological Industries, #04-007-1A).
4
Immunofluorescent Analysis of Setd1A and β-catenin in NSCLC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NSCLC cells were fixed with 95% ethyl alcohol at room temperature for 30 min and permeabilized with 0.2% Triton X-100 (Beyotime) for 15 min. After blocking with 5% BSA (Solarbio), the cells were incubated with the anti-Setd1A antibody (sc-515,590; Santa Cruz Biotechnology), anti-β-catenin antibody (sc-7963; Santa Cruz Biotechnology) normal rabbit IgG (#2729; Cell Signaling Technology) and normal mouse IgG (A7028; Beyotime) at 4 °C overnight. Next, the cells were incubated with Alexa Fluor 488-labeled Goat Anti-Rabbit IgG (H + L) (A0423; Beyotime) and Cy3-labeled Goat Anti-Mouse IgG (H + L) (A0521; Beyotime) for 1 h at room temperature. After that, the cells were stained with DAPI (C1002; Beyotime) to visualize the nuclei. Finally, the cells were viewed and imaged under a laser scanning confocal microscope (Leica, Bensheim, Germany).
5
Immunofluorescent Localization of Foxo3a/b and Cyp19a1a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunofluorescence was performed as described previously (Lu et al. 2014) (link). Briefly, deparaffinized sections were boiled for 15 min in 10 mM sodium citrate buffer (pH 6.0) for antigen retrieval, and blocked in 0.01 M PBS containing 10% normal goat serum for 30 min at room temperature. The blocked sections were then incubated in a primary antiserum mixture of mouse anti-Foxo3a (1:100) or anti-Foxo3b (1:100) with rabbit anti-Cyp19a1a (1:100; Lu et al. 2014 (link)) overnight at 4°C. After rinsing with PBS for 10 min, the sections were exposed to the secondary antibody, a mixture of Cy3-labeled goat anti-mouse IgG (H + L) (1:500, catalog number: A0521; Beyotime) and FITC-conjugated goat anti-rabbit IgG (H + L) (1:500; Jackson ImmunoResearch Laboratories Inc.) for 2 h. After washing three times in PBS for 10 min, the sections were counterstained with 5 µg/mL 2-[4-amidinopheny]-6-indolecarbamidine (DAPI) (Beyotime), a nuclear counterstain, for 20 min at room temperature. After rinsing with PBS for 10 min, the sections were coverslipped using an anti-fade fluorescent mounting medium (Beyotime) and stored in the dark at 4°C. The stained sections were examined under a Zeiss LSM 7 Duo NLO laser scanning confocal microscope (Carl Zeiss). The photographs taken from each photomultiplier were subsequently merged so that the different-colored labels could be visualized simultaneously.
6
Immunofluorescence Staining of EPHB2 and HMGB1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fix the HAECs growing on the slides with 4% paraformaldehyde (Beyotime, China) for 30 min. Then the cells were permeabilized with 0.5% Triton X-100 for 15 min and blocked with 5% goat serum (Boster Biotechnology, China), followed by incubation with antibodies for overnight at 4 °C. Antibodies used here are rabbit anti-EPHB2 (Cell Signaling Technology, USA), mouse anti HMGB1 (Proteintech, USA), Alexa Fluor 488-labeled Goat Anti-Rabbit IgG(H + L) (Beyotime, China) and Cy3-labeled Goat Anti-Mouse IgG (H + L) (Beyotime, China). The Nuclear DNA was stained with Hoechst 33342 (ThermoFisher, USA). Images were acquired with a fluorescence microscope (Olympus IX71, Japan).
7
Immunofluorescent Staining of Ferroptosis Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed with phosphate-buffered saline (PBS) and fixed with 4% formaldehyde for 10 minutes at room temperature. After washing with PBS, the cells were covered with blocking medium (0.25% Triton X-100 and 5% goat serum in PBS) for 1 hour at room temperature. Then, the cells were incubated with the primary antibodies overnight at 4°C. After washing, the cells were incubated with secondary antibodies for 1 hour at room temperature. 4′,6-diamidino-2-phenylindole (Cat# C0065; Beijing Solarbio Science & Technology, Beijing, China) was used for nuclear staining. Images were captured on a fluorescence microscope (Cat# TH4-200; Olympus, Tokyo, Japan) and analyzed with Image Pro-Plus 6.0 (https://www.mediacy.com/ . Primary antibodies included GPX4 (rabbit; 1:100; Cat# ab125006; Abcam, Cambridge, MA, USA), oligodendrocyte transcription factor 2 (Oligo2; goat; 1:200; Cat# F2418; R&D Systems, Minneapolis, MN, USA) and ferroptosis suppressor protein 1 (FSP1, also known as AIFM2; rabbit; 1:200; Cat# BS7655; Bioss, Woburn, MA, USA). Secondary antibodies were Alexa Fluor 488-conjugated goat anti-rabbit IgG (H+L) (1:500; Cat# ab150077; Abcam) and Cy3-labeled goat anti-mouse IgG (H+L) (1:500; Cat# A0521; Beyotime Biotechnology, Shanghai, China).
8
Quantifying Autophagic Flux in PK-15 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PK-15 cells were seeded on coverslips in six-well cell culture plates and transfected with the corresponding plasmids for 36h. Then, the cells were fixed with 4°C precooled anhydrous methanol at room temperature for 10min after washing the coverslips three times with PBS. The cells were blocked with 5% bovine serum albumin for 45min, and then a rabbit polyclonal anti-LC3B antibody, a rabbit polyclonal anti-Myc-tag antibody, or a mouse monoclonal anti-Flag-Tag antibody was added to the cells and incubated at 4°C overnight. Next, after being washed three times with PBS, the samples were incubated with the secondary antibody CoraLite488-conjugated AffiniPure goat anti-rabbit IgG (H+L; Proteintech) or Cy3-labeled goat anti-mouse IgG (H+L; Beyotime, China) at 37°C in the dark for 2h. After washing three times with cold PBS, the cell nuclei were stained with 2.5μg/ml DAPI (Sigma, D9542) in PBS for 15min at 37°C. The samples were observed using a confocal scanning laser microscope (Zeiss LSM880). PK-15 cells were transiently transfected with mRFP-eGFP-LC3 constructs to monitor autophagic flux. After 36h, the cells were treated with the indicated compounds (The autolysosome inhibitor bafilomycin A1, BAF) for 12h. All samples were analyzed using a laser scanning confocal microscope.
9
Immunofluorescence Staining Protocol for Retinal Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the primers used in this study were synthesized by Shanghai Sangon Biological Engineering Technology and Services. The primers were ID3-F:
5′ GAGAGGCACTCAGCTTAGCC3’, ID3-R:
5′TCCTTTTGTCGTTGGAGATGAC3’; RARRES2-F: 5′GCATCAAACTGGGCTCTGAG3′, RARRES2-R: 5′AGGGAAGTAGAAGCTGTGGG3’; CRYAB-F: 5′GGGAGATGTGATTGAGGTGC3′, CRYAB-R: 5′TTCACAGTGAGGACCCCATC3’; FBXO32-F: 5′TGTGGGTGTATCGGATGGAG3′, FBXO32-R: 5′GAGTTTCTTCCACAGCAGCC3’; CHCHD10-F: 5′CAGAGTGACCTGTCCCTGTG3′, and CHCHD10-R: 5′CCTCCTCACTTCCAATCCCA3’. Cy3-labeled goat anti-rabbit IgG (H + L) (Beyotime, A0516, 1:500), Cy3-labeled goat anti-mouse IgG (H + L) (Beyotime, A0521, 1:500), Alexa Fluor 488-labeled goat anti-mouse IgG (H + L) (Beyotime, A0428, 1:500) and DAPI were purchased from Beyotime. RPE-65 (Abcam ab231782, 1:1,000), ID3 (Cell Signaling Technology #9837, 1:500), and crystallin antibodies (Abcam, ab230722, 1:500) were used for immunofluorescence visualization (SP8; Leica).
5′ GAGAGGCACTCAGCTTAGCC3’, ID3-R:
5′TCCTTTTGTCGTTGGAGATGAC3’; RARRES2-F: 5′GCATCAAACTGGGCTCTGAG3′, RARRES2-R: 5′AGGGAAGTAGAAGCTGTGGG3’; CRYAB-F: 5′GGGAGATGTGATTGAGGTGC3′, CRYAB-R: 5′TTCACAGTGAGGACCCCATC3’; FBXO32-F: 5′TGTGGGTGTATCGGATGGAG3′, FBXO32-R: 5′GAGTTTCTTCCACAGCAGCC3’; CHCHD10-F: 5′CAGAGTGACCTGTCCCTGTG3′, and CHCHD10-R: 5′CCTCCTCACTTCCAATCCCA3’. Cy3-labeled goat anti-rabbit IgG (H + L) (Beyotime, A0516, 1:500), Cy3-labeled goat anti-mouse IgG (H + L) (Beyotime, A0521, 1:500), Alexa Fluor 488-labeled goat anti-mouse IgG (H + L) (Beyotime, A0428, 1:500) and DAPI were purchased from Beyotime. RPE-65 (Abcam ab231782, 1:1,000), ID3 (Cell Signaling Technology #9837, 1:500), and crystallin antibodies (Abcam, ab230722, 1:500) were used for immunofluorescence visualization (SP8; Leica).
10
Immunofluorescence Staining of Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunofluorescence was performed as described previously [33 (link)]. Macrophages in eight-well culture slides or aortic sections were fixed with 4% paraformaldehyde in PBS for 10 min. Blocking was performed with immunofluorescence buffer (PBS, 2% bovine serum albumin (BSA), 10% FBS) for 1 h, followed by a 10-min incubation with a second immunofluorescence buffer (PBS, 0.4% Triton X-100). Cells/tissues were incubated with primary antibody against F4/80 (Abcam, 1:200) and swiprosin-1 (Santa Cruz Biotechnology, 1:50) for 3 h at room temperature in a humidified chamber. After washing, cells were incubated with Cy3-labeled goat anti-mouse IgG (H + L) or Alexa Fluor 488-labeled goat anti-rabbit IgG (Beyotime, 1:200) for 1 h. 4′,6-Diamidino-2-phenylindole (DAPI) (Beyotime) was used for nuclear staining. Images were acquired using a fluorescence microscope (Olympus IX71, Olympus, Tokyo, Japan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!