SARS-CoV-2 infected mice were euthanized using a ketamine and xylazine cocktail, and organs were collected. Tissues were weighed and homogenized with beads using a MagNA Lyser (Roche) in 1 mL of Dulbecco’s Modified Eagle’s Medium (DMEM) containing 2% fetal bovine serum (FBS). RNA was extracted from clarified tissue homogenates using MagMax mirVana Total RNA isolation kit (Thermo Scientific) and the KingFisher Flex extraction system (Thermo Scientific). SARS-CoV-2 RNA levels were measured by one-step quantitative reverse transcriptase PCR (qRT-PCR) TaqMan assay as described previously (Hassan et al., 2020a (link)). SARS-CoV-2 nucleocapsid (N) specific primers and probe sets were used: (N: F Primer: ATGCTGCAATCGTGCTACAA; R primer: GACTGCCGCCTCTGCTC; probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ) (Integrated DNA Technologies). Viral RNA was expressed as (N) gene copy numbers per milligram on a log10 scale.
Kingfisher flex extraction system
Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom, United States
The KingFisher Flex extraction system is a fully automated benchtop instrument designed for nucleic acid and protein extraction and purification. It utilizes magnetic particle technology to efficiently process samples, enabling high-throughput processing with minimal hands-on time.
Automatically generated - may contain errors
Lab products found in correlation
6 protocols using kingfisher flex extraction system
1
SARS-CoV-2 Viral Load Quantification in Mice
2
Viral RNA Extraction and RT-PCR Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted from EDTA whole blood samples using MagVet Universal Isolation Kits (ThermoFisher Scientific, Paisley, UK) with the KingFisher Flex Extraction System (ThermoFisher Scientific, Paisley, UK). The extracted RNA was amplified with a group-specific rRT-PCR (Maan et al., 2017 (link)) using an Applied Biosystems 7500 Real-Time PCR System (ThermoFisher Scientific, Paisley, UK).
3
ASFV Genomic DNA Extraction and qPCR Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 100 μl of sample supernatant using the KingFisher Flex Extraction System (Thermo Scientific) using the MagVet™ Universal Isolation Kit (Life Technologies) following protocol NM_LSI_RRC96. Each extraction was carried out in duplicate and contained ASFV Georgia 2007/1 as a positive control and PBS as a negative control. Extracted DNA was stored at 4°C until it could be analysed by qPCR. qPCR was carried out on a Stratagene Mx3005P (Agilent Technologies, Santa Clara, CA, USA) following a protocol modified from King et al., 2003 as described by King et al., 2011 . A standard curve was constructed by the serial dilution of control plasmid, and genome copies were calculated from the standard curve based on the cycle threshold (Ct) values. Ct values >40 were considered negative.
4
Quantification of ASFV in Whole Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole blood samples were collected in EDTA at different days during the experiments. Viral nucleic acid was extracted using MagVet Universal isolation kit and the automated KingFisher Flex extraction system (Thermo Fisher Scientific). Samples from different days were extracted in duplicate, and the extracted DNA was then subjected to qPCR as described previously (51 (link)). The results are presented as genome copies/mL blood. A cutoff for accurate detection was based on the serial 10-fold dilutions of a control plasmid, where the lowest value is 1 copy. This translates to a cutoff accurate measurement of 1.59 × 102 ASFV genome copies/mL. Below this, the exact genome copy cannot be determined. We defined levels of virus genome less than 104 genome copies/mL as low, 104 to 106 genome copies/mL as moderate, and more than 106 as high.
5
Quantifying SARS-CoV-2 Viral Load in Mouse Organs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SARS-CoV-2 infected mice were euthanized using a ketamine and xylazine cocktail, and organs were collected. Tissues were weighed and homogenized with beads using a MagNA Lyser (Roche) in 1 mL of Dulbecco’s Modified Eagle’s Medium (DMEM) containing 2% fetal bovine serum (FBS). RNA was extracted from clarified tissue homogenates using MagMax mirVana Total RNA isolation kit (Thermo Scientific) and the KingFisher Flex extraction system (Thermo Scientific). SARS-CoV-2 RNA levels were measured by one-step quantitative reverse transcriptase PCR (qRT-PCR) TaqMan assay as described previously (Hassan et al., 2020 (link)). SARS-CoV-2 nucleocapsid (N) and Open Reading Frame 1a (ORF1a) specific primers and probe sets were used: (N: F Primer: ATGCTGCAATCGTGCTACAA; R primer: GACTGCCGCCTCTGCTC; probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/; ORF1a: F Primer: TTCAGTTGACTTCGCAGTGG; R primer: GGACGGGTTTGAGTTTTTCA; probe: /56-FAM/AACTAACAT/ZEN/CTTTGGCACTGTTT/3IABkFQ) (Integrated DNA Technologies). Viral RNA was expressed as (N) or (ORF1a) gene copy numbers per milligram on a log10 scale. For some samples, viral titer was determined by plaque assay on Vero E6 cells.
6
Viral DNA Extraction and Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wells containing fluorescent cells were selected for viral genomic DNA extraction using the MagVet™ Universal Isolation Kit (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s protocol, with minor modifications, including the use of a 40 μL instead of a 100 μL initial test sample, and the final elution in 60 μL of Elution Buffer NM6 instead of the recommended 80 μL. The lysed samples were extracted on the high-throughput KingFisher™ Flex Extraction System (Thermo Fisher Scientific, Waltham, MA, USA), using programmed script NM_LSI_RRC96. Extracted viral DNA was then subjected to PCR amplification to confirm the intended deletions, to verify the absence of carry-over parental virus and the presence of the fluorescent reporter gene (Table 1 ). The viral genomic DNA extraction and PCR amplifications were repeated after the limiting dilutions steps and the final virus propagation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!