Log In Sign up
The largest database of trusted experimental protocols

Sybr green taq readymix

Manufactured by Merck Group
Visit Supplier
Sourced in United States

SYBR Green Taq ReadyMix is a pre-optimized, ready-to-use solution for real-time PCR. It contains all the necessary components for amplification, including Taq DNA polymerase, dNTPs, and SYBR Green I dye.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (3 mentions) Abi prism 7900 system, by Thermo Fisher Scientific (3 mentions) Superscript first strand cdna system, by Thermo Fisher Scientific (2 mentions) Omniscript reverse transcriptase, by Qiagen (2 mentions) Rneasy kit, by Qiagen (2 mentions) Taqman mir assay, by Thermo Fisher Scientific (1 mentions) 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions) Tetro cdna synthesis kit, by Meridian Bioscience (1 mentions) Trizol reagent, by Merck Group (1 mentions) Fast prep homogenizer, by Thermo Fisher Scientific (1 mentions) Advantage cdna pcr kit, by BD (1 mentions) E gel, by Thermo Fisher Scientific (1 mentions) Lux primer set, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Mirscript 2 rt kit, by Qiagen (1 mentions) Tri reagent, by Merck Group (1 mentions) Goscript reverse transcription kit, by Promega (1 mentions) Trizol, by Merck Group (1 mentions) Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)

9 protocols using sybr green taq readymix

1

Quantitative Analysis of H19 and VDAC1 in Cardiomyocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from myocardial tissues and neonatal cardiomyocytes using TRIzol Reagent (Invitrogen). RNA was reverse transcribed using SuperScript First Strand cDNA System (Invitrogen) according to the manufacturer’s instructions. Quantitative PCR was conducted using SYBR Green Taq ReadyMix (Sigma) on an Applied Biosystems 7500 Real-Time PCR System, and GAPDH was used as the endogenous control. The primer sequences are as follows: H19, 5′-TATCGGACTCCAGAGGGATT-3′ and 5′-GGCATACAGTGCACCAAGTC-3′; VDAC1, 5′-TGCCATTTTAGGGTGGAGAG-3′ and 5′-GTGCGGCTACAAGAGGAGTC-3′. For miRNA real-time PCR, the miR-specific primers from the TaqMan miR assays (Applied Biosystems) were applied, and the snRNA U6 was used as an endogenous reference.
Li X., Wang H., Yao B., Xu W., Chen J, & Zhou X. (2016). lncRNA H19/miR-675 axis regulates cardiomyocyte apoptosis by targeting VDAC1 in diabetic cardiomyopathy. Scientific Reports, 6, 36340.
+ Open protocol
+ Expand
2

Quantitative RT-PCR for IL-6 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from cell cultures using TRIzol reagent (Sigma) and reverse transcribed to complementary DNA using Tetro cDNA synthesis kit (Bioline) according to the manufacturer’s recommendations. Real-time quantitative PCR was performed with SYBR Green Taq ReadyMix (Sigma), using the following primer pairs for human IL-6: sense 5′-AGTTCCTGCAGAAAAAGGCA-3′ and antisense 5′-AAAGCTGCGCAGAATGAGAT-3′ and human 18sRNA: sense 5′-GGGAGGTAGTGACGAAAAAT-3′ and antisense 5′-ACCAACAAAATAGAACCGCG-3′. Data were analyzed using an ABI Prism 7900 system (Applied Biosystems) and were normalized to a GAPDH reference. Real-time PCR data were analyzed using the 2−ΔΔCt method [25] (link).
Lazzari E., Korczeniewska J., Ní Gabhann J., Smith S., Barnes B.J, & Jefferies C.A. (2014). TRIpartite Motif 21 (TRIM21) Differentially Regulates the Stability of Interferon Regulatory Factor 5 (IRF5) Isoforms. PLoS ONE, 9(8), e103609.
+ Open protocol
+ Expand
3

Quantitative Real-Time PCR Analysis of Rat Slit and Robo

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rat brain and vascular tissues were homogenized in lysis buffer (RLT, Qiagen) at 4°C using a Fast Prep homogenizer (Thermo Electron Corporation). Total RNA was isolated using RNeasy Mini Kits (Qiagen). RNA was reverse-transcribed with oligo-dT priming using the Advantage cDNA PCR kit (BD Biosciences, San Jose, CA). Primer sets used to amplify rat Slit ligands, Robo receptors and ICAM-1 are listed in Table 1. Relative quantitative real-time PCR was performed using the Roche LightCycler real-time thermal cycler (Roche Diagnostics). cDNA samples (100 ng each) were mixed with primers and the SYBR green Taq Ready Mix (Sigma, St. Louis, MO) for a total volume of 20 μl. Each gene was normalized to 18s (human/rat/mouse 18s, Lux primer set, Invitrogen) from the same sample. Amplified products were analyzed by electrophoresis on 2% agarose gels containing ethidium bromide (E-gels, Invitrogen) to confirm primer specificity. Rat β-actin (Lux primer set, Invitrogen) was amplified from the same cDNA samples for electrophoretic analysis.
Liu D., Xiao Y., Subramanian R.R., Okamoto E.I., Wilcox J.N., Anderson L, & De Leon H. (2016). Potential Role of Axonal Chemorepellent Slit2 in Modulating Adventitial Inflammation in a Rat Carotid Artery Balloon Injury Model. Journal of cardiovascular pharmacology, 67(5), 433-441.
+ Open protocol
+ Expand
4

Cardiac Gene Expression Analysis by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cardiac tissue and cells using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). RNA was reverse transcribed using SuperScript First Strand cDNA System (Invitrogen, USA). Quantitative PCR was performed using SYBR Green Taq ReadyMix (Sigma, USA) on an Applied Biosystems 7500 PCR system. GAPDH was used as the endogenous control in this study. The primer sequences are as follows: MIAT, 5′-GAGGGAAGTTCTGAGCTTGG-3′ and 5′-CCTTTCTTCTGGGCTGAGAC-3′ DAPK2, 5′-TCCTGGATGGGGTGAACTAC-3′ and 5′-CAGCTTGATGTGTGGAATGG-3′ GAPDH, 5′-TGCCCAGAACATCATCCCT-3′ and 5′-GGTCCTCAGTGTAGCCCAAG-3′. The relative expression of genes was presented as fold change and calculated using the 2−ΔΔCT method.
Zhou X., Zhang W., Jin M., Chen J., Xu W, & Kong X. (2017). lncRNA MIAT functions as a competing endogenous RNA to upregulate DAPK2 by sponging miR-22-3p in diabetic cardiomyopathy. Cell Death & Disease, 8(7), e2929-.
+ Open protocol
+ Expand
5

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using an RNeasy kit (Qiagen) and reverse transcribed to cDNA using Omniscript reverse transcriptase (Qiagen) according to manufacturer’s recommendations. Quantitative real-time PCR was performed using SYBR Green Taq ReadyMix™ (Sigma) and the data was normalised to a β-actin reference. Real-time PCR data was analyzed using the 2−ΔΔCt method [31] (link).
Ní Gabhann J., Hams E., Smith S., Wynne C., Byrne J.C., Brennan K., Spence S., Kissenpfennig A., Johnston J.A., Fallon P.G, & Jefferies C.A. (2014). Btk Regulates Macrophage Polarization in Response to Lipopolysaccharide. PLoS ONE, 9(1), e85834.
+ Open protocol
+ Expand
6

Conjunctival Epithelial RNA Extraction and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNAs were extracted from conjunctival epithelial cells using TRI Reagent® (Sigma). Samples were reverse transcribed to complementary DNA using Tetro cDNA Synthesis Kit (Bioloine) or miRScript II RT kit (Qiagen) according to the manufacturer’s recommendations for gene and miR analysis respectively. Real-time quantitative PCR investigating gene expression was performed using primer sequences in Table 2 with SYBR Green Taq ReadyMix (Sigma) as per manufacturer’s recommendations. Data were analyzed using an ABI Prism 7900 system (Applied Biosystems). Genes were normalised to an RNU6B reference. miRs were normalised to the U6 small nuclear RNA (U6 snRNA). Real-time PCR data were analyzed using the 2-ddct method67 (link).

Real-time quantitative PCR primer sequences.

Gene/miRForward primerReverse Primer
miR-744-5pAAGGTGCGGGGCTAGGGCTAAAGTAAGGTTGAGGTTA
Pellino3GATGGCCTGATGGATGGACTGAGGTCGATGAGAGAGCCGTC
Rantes (CCL5)CCTCGCTGTCATCCTCATTGCTTACTCCCGAACCCATTTCTTCTC
CXCL10GGAAGCACTGCATCGATTTTGCAGAATCGAAGGCCATCAAGA
CK18GGCATCCAGAACGAGAAGGAGATTGTCCACAGTATTTGCGAAGA
CK19ACCAAGTTTGAGACGGAACAGCCCTCAGCGTACTGATTTCCT
RNU6BCTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT
18 sGGGAGGTAGTGACGAAAAATACCAACAAAATAGAACCGCG
Pilson Q., Smith S., Jefferies C.A., Ní Gabhann-Dromgoole J, & Murphy C.C. (2020). miR-744-5p contributes to ocular inflammation in patients with primary Sjogrens Syndrome. Scientific Reports, 10, 7484.
+ Open protocol
+ Expand
7

Quantitative RT-PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from cell cultures using Trizol™ (Sigma) and reverse transcribed to complementary DNA using the GoScript Reverse Transcription kit (Promega), as per manufacturer’s instructions. Real-time quantitative PCR investigating gene expression was performed using primers listed in Table 1, with SYBR Green Taq ReadyMix (Sigma) according to manufacturer’s recommendations. Data were analyzed using an ABI Prism 7900 system (Applied Biosystems) and were normalized to 18 s RNA. Real-time PCR data were analyzed using the 2−ΔΔct method70 (link).

Human primers used in this study.

Primer NamePrimer SequenceProduct Size(bp)
La senseGAAGGAGAGGTGGAAAAAG372
La anti-senseAAGCCCCGCAAACAAAAG
IFN-β senseCTAGCACTGGCTGGAATGAGA217
IFN-β anti-senseCTGACTATGGTCCAGGCACA
18 S senseTTGACGGAAGGGCACCACCA131
18 S anti-senseGCACCACCACCCACGGAATCG
IFN-λ1 senseGGACGCCTTGGAAGAGTCACT84
IFN-λ1 anti-senseAGAAGCCTCAGGTCCCAATTC
CXCL-10 senseGGAAGCACTGCATCGATTTTG519
CXCL-10 anti-senseCAGAATCGAAGGCCATCAAGA
CXCL-11 senseGCCTTGGCTGTGATATTGTGTG686
CXCL-11 anti-senseCACTTTCACTGCTTTTACCCCAG
Mahony R., Broadbent L., Maier-Moore J.S., Power U.F, & Jefferies C.A. (2017). The RNA binding protein La/SS-B promotes RIG-I-mediated type I and type III IFN responses following Sendai viral infection. Scientific Reports, 7, 14537.
+ Open protocol
+ Expand
8

Quantitative Real-Time PCR of RNA Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cell cultures using an RNeasy kit (Qiagen) and reverse transcribed to cDNA using Omniscript reverse transcriptase (Qiagen) according to manufacturer's recommendations. Quantitative real-time PCR was performed using SYBR Green Taq ReadyMix (Sigma) on an Applied Biosystems 7500 real-time PCR machine and the data was normalised to an 18S RNA reference. IFN-β, TRIM68 and 18S RNA templates were amplified using primers (sequences available on request) with an annealing temperature of 56°C. Real-time PCR data was analysed using the 2−ΔΔCt method [33] (link).
Wynne C., Lazzari E., Smith S., McCarthy E.M., Ní Gabhann J., Kallal L.E., Higgs R., Cryan S.A., Biron C.A, & Jefferies C.A. (2014). TRIM68 Negatively Regulates IFN-β Production by Degrading TRK Fused Gene, a Novel Driver of IFN-β Downstream of Anti-Viral Detection Systems. PLoS ONE, 9(7), e101503.
+ Open protocol
+ Expand
9

Quantifying Gene Expression in Nasopharyngeal Carcinoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from NPC tissues and cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Then, cDNA was established from total RNA using the PrimeScript™ 1st strand cDNA Synthesis Kit (cat. no. 6110A; Takara Biotechnology Co., Ltd.) according to the manufacturer's protocol. qPCR was performed using SYBR Green Taq ReadyMix (Sigma-Aldrich; Merck KGaA) on an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The following thermocycling conditions were used for qPCR: Initial denaturation at 95°C for 15 sec; 40 cycles of denaturation at 94°C for 30 sec, annealing at 60°C for 20 sec and extension at 72°C for 40 sec. The expression of genes was detected using the 2−ΔΔCq method (28 (link)). GAPDH or U6 were used as the internal controls for FBXL19-AS1 and PBOV1 or miR-431, respectively. The primer sequences were as follows: FBXL19-AS1 forward, 5′-GGTACAACTACGGATATGA-3′ and reverse, 5′-TACGTCTCGACCATTACGCA-3′; miR-431 forward, 5′-TGTCTTGCAGGCCGTCATG-3′ and reverse, 5′-GCTGTCAACGATACGCTACCTA-3′; PBOV1 forward, 5′-TGAGTCCCCTCTCGGTAATG-3′ and reverse, 5′-GCCCCGAGTTAAGAACATCA-3′; GAPDH forward, 5′-ACCACAGTCCATGCCATCAC-3′ and reverse, 5′-TCCACCACCCTGTTGCTGTA-3′; and U6 forward, 5′-ATTGGAACGATACAGAGAAGATT-3′ and reverse, 5′-GGAACGCTTCACGAATTTG-3′.
Dong H., Huang C, & Huang J. (2021). FBXL19-AS1 promotes the progression of nasopharyngeal carcinoma by acting as a competing endogenous RNA to sponge miR-431 and upregulate PBOV1. Molecular Medicine Reports, 24(3), 647.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!