Genomic DNA was isolated from cell pellets using the DNeasy Blood and Tissue Kit (Qiagen 69504). Quantitative PCR was run using NEB Luna Universal One-Step RT-qPCR without the RT enzyme mix and run on a Viia7 thermocycler. Relative quantification of mitochondrial genomes was determined by measuring the relative abundance of mitochondrially encoded gene Nd1 to the abundance of nuclear encoded Hk2 as has been described elsewhere (Field et al., 2020 (link)). All primers are detailed as follows:
Luna universal one step rt qpcr
Manufactured by New England Biolabs
Sourced in United Kingdom, United States
The Luna® Universal One-Step RT-qPCR is a reagent system designed for the reverse transcription and real-time quantitative PCR (RT-qPCR) of RNA targets. It enables the detection and quantification of RNA transcripts in a single-tube reaction.
Automatically generated - may contain errors
Lab products found in correlation
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Triton x 100, by Merck Group (1 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Turbo dnase, by Thermo Fisher Scientific (1 mentions)
Rnasy plus mini kit, by Qiagen (1 mentions)
Eco real time pcr instrument, by Illumina (1 mentions)
5 protocols using luna universal one step rt qpcr
1
Quantitative Analysis of Mitochondrial Genomes
2
Quantification of SARS-CoV-2 RNA in Cells and Virions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of virion-associated RNA, total RNA of infected cells was extracted from half of the cell-associated lysate with RNeasy mini kit (Qiagen), treated with TURBO DNase (Thermo Fisher Scientific) and retro-transcribed using the High Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific) according to the manufacturer instructions. cDNAs were quantified with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) using specific sets of primers (Supplementary Table 1 ). For quantification of virion-associated RNA, 5% of the collected supernatants were lyzed in PBS, 1% Triton X-100 (Merck) during 30 min. RNA was retro-transcribed and cDNA was quantified with Luna Universal One-Step RTq-PCR (New England BioLabs) using primers specific of SARS-CoV-2 gRNA (Supplementary Table 1 ).
3
RNA Extraction from Saliva Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR (RT-PCR) was used to verify the success of MF1 and Fusion 5™ membranes for RNA extraction from saliva samples. B-Actin housekeeping primer was used as quality control of RNA obtained (sense ATTGCCGACAGGATGCAGA and antisense ATTGCCGACAGGATGCAGA). The elute RNA from 0.6 × 6 cm membranes MF1 and Fusion 5™ were evaluated for amplification. The PCR mix contained 10 μL of the amplification reagents, comprising 0.2 μL forward and reverse primers, 5 μL of Luna® Universal One-Step RT-qPCR (New England Biolabs NEB, UK), 0.5 μL of retrotranscriptase enzyme, 2.3 μL of ddH2O, and 2 μL of RNA template solution. CT values were evaluated with RT-PCR.
4
Quantitative RT-PCR Analysis of Oncogene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCT116 cells were seeded (60 mm Petri dishes) at a density of 3 × 105 cells/dish and grown overnight. Tested compounds were then added at concentrations corresponding to 1×, 2×, and 3× IC50 values (determined in the previous experiment). Following a 24-h incubation, the cells were harvested, washed, and pelleted. RNA was extracted from the pellets using RNasy® Plus Mini Kit (QIAGEN) according to the manufacturer’s instructions. A one-step RT-qPCR assay combining reverse transcription and amplification thermal cycling was used (Luna® universal one-step RT-qPCR; New England Biolabs, MA, USA). The reactions were run on Illumina Eco real-time PCR instrument (Illumina, CA, USA) using the following thermal profiles: 10 min at 55 °C (reverse transcription); 1 min at 95 °C (initial denaturation); 43 cycles of 10 s at 95 °C and 30 s at 60 °C (denaturation and extension, respective). The following primer sequences were used; GAPDH-F, 5′-GTCTCCTCTGACTTCAACAGCG-3″; GAPDH-R, 5′-ACCACCCTGTTGCTGTAGCCAA-3″; C-MYC-F, 5′-CCTGGTGCTCCATGAGGAGAC-3″; C-MYC-R, 5′-CAGACTCTGACCTTTTGCCAGG-3″; K-RAS-F, 5′- TGTTCACAAAGGTTTTGTCTCC −3″; K-RAS-R, 5′- CCTTATAATAGTTTCCATTGCCTTG −3″. Melting curve analysis and template-free negative controls were run to confirm specific single-product amplification. GAPDH was used as the internal control. Relative mRNA expression is shown as fold change (2−ΔΔCt)39 (link).
5
Gene Expression Analysis in Fenugreek and Lotus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen regenerated fenugreek or Lotus japonicus roots, identified as transformed by PCR, were ground under liquid nitrogen and used to extract total RNA using a modified LiCl procedure (Brusslan & Tobin, 1992). The expression levels of TSAR1, TSAR2 [73] and predicted transcripts for fenugreek HMGR [86] and CAS [87] and putative Lotus japonicus HMGRs1-3 were estimated by Luna® Universal One-
Step RT-qPCR (New England Biolabs), using specific primers for each gene. To normalize the expression results, the translation Elongation Factor1α (EF1-α) [36] was used as an endogenous gene previously identified in fenugreek RNA sequencing.
Lotus japonicus Ubiquitin1 was used as an internal reference for qPCRs on Lotus japonicus RNA as described in [76] . Two to three technical replicate reactions were carried out per sample. The reaction conditions were: reverse transcription at 55 ο C for 10 min and then 40 cycles of 95 ο C for 10 sec, 60 ο C for 30 sec and melt-curve at 65-95 ο C with increment 0.5 ο C every 5 sec. Data analysis was performed according to the ΔC T method (Livak & Schmittgen, 2001), with all data being expressed as mean ± SD (standard deviation).
Step RT-qPCR (New England Biolabs), using specific primers for each gene. To normalize the expression results, the translation Elongation Factor1α (EF1-α) [36] was used as an endogenous gene previously identified in fenugreek RNA sequencing.
Lotus japonicus Ubiquitin1 was used as an internal reference for qPCRs on Lotus japonicus RNA as described in [76] . Two to three technical replicate reactions were carried out per sample. The reaction conditions were: reverse transcription at 55 ο C for 10 min and then 40 cycles of 95 ο C for 10 sec, 60 ο C for 30 sec and melt-curve at 65-95 ο C with increment 0.5 ο C every 5 sec. Data analysis was performed according to the ΔC T method (Livak & Schmittgen, 2001), with all data being expressed as mean ± SD (standard deviation).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!