Itaq universal sybr green reagent

Manufactured by Bio-Rad

The ITaq Universal SYBR Green reagent is a ready-to-use solution for real-time PCR amplification and detection. It contains all the necessary components, including the ITaq DNA polymerase, SYBR Green I dye, and buffer, for the quantification of gene expression levels.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (2 mentions) Iscript cdna synthesis kit, by Bio-Rad (2 mentions) Revertaid h minus reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Pcr cycler, by Bio-Rad (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Cfx connect real time pcr cycler, by Bio-Rad (1 mentions) Pico kit, by Agilent Technologies (1 mentions) Agilent 2100, by Agilent Technologies (1 mentions) E z n a total rna kit, by Omega Bio-Tek (1 mentions) Cfx connect real time pcr system, by Bio-Rad (1 mentions) Nucleospin rna extraction kit, by Macherey-Nagel (1 mentions)

6 protocols using itaq universal sybr green reagent

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with TRIzol (Thermo Fisher Scientific), phase-separated with chloroform, and precipitated using isopropanol. One microgram of RNA was reverse-transcribed using iScript cDNA Synthesis Kit (Bio-Rad), according to the manufacturer’s instructions. iTaq Universal SYBR green reagent (Bio-Rad) was used to detect gene expression during amplification of complementary DNA after initial denaturation at 95°C for 30 s for one cycle and 95°C for 5 s and 60°C for 30 s for 40 cycles on a polymerase chain reaction (PCR) cycler (Bio-Rad). The mouse primer sequences are as follows:
OSX (forward, TGCCTGACTCCTTGGGACC; reverse, TAGTGAGCTTCTTCCTCAAGCA), OPN (forward, AAACCAGCCAAGGTAAGCCT; reverse, TCAGTCACTTTCACCGGGAG), NFATC1 (forward, GGTAACTCTGTCTTTCTAACCTTA; reverse, GTGATGACCCCAGCATGCACCAGTCACAG), CTSK (forward, GGGCTCAAGGTTCTGCTGC; reverse, TGGGTGTCCAGCATTTCCTC), ACP5 (forward, CAGCAGCCCAAAATGCCT; reverse, TTTTGAGCCAGGACAGCTGA), ESR1 (forward, CTTGAACCAGCAGGGTGGC; reverse, GAGGCTTTGGTGTGAAGGGT), ESR2 (forward, GACGAAGAGTGCTGTCCCAA; reverse, GCCAAGGGGTACATACTGGAG), ADORA2B (forward, ATCTTTAGCCTCTTGGCGGTG; reverse, GACCCAGAGGACAGCAATGAT), and 18S ribosomal RNA (forward, ACCAGAGCGAAAGCATTTGCCA; reverse, ATCGCCAGTCGGCATCGTTTAT).

Shih Y.R., Liu M., Kwon S.K., Iida M., Gong Y., Sangaj N, & Varghese S. (2019). Dysregulation of ectonucleotidase-mediated extracellular adenosine during postmenopausal bone loss. Science Advances, 5(8), eaax1387.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis from Lung Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation from the lungs was performed using TRIzol™ Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Complementary DNA was transcribed using the RevertAid H Minus Reverse Transcriptase (Fermentas, Waltham, MA) kit. For detection of the transcript, the iTaq Universal SYBR Green reagent (Biorad, Hercules, CA) and a Biorad CFX Connect Real Time polymerase chain reaction system were utilized, using specific primers depicted in Table S4. For determination of relative gene expression ratios, the Pfaffl method was applied. Calculation of bestkeeper values was performed using actin beta (ACTB), 28S and TATA‐box binding protein (TBP) as housekeeping genes.34

Mohrherr J., Haber M., Breitenecker K., Aigner P., Moritsch S., Voronin V., Eferl R., Moriggl R., Stoiber D., Győrffy B., Brcic L., László V., Döme B., Moldvay J., Dezső K., Bilban M., Popper H., Moll H.P, & Casanova E. (2019). JAK–STAT inhibition impairs K‐RAS‐driven lung adenocarcinoma progression. International Journal of Cancer, 145(12), 3376-3388.

+ Open protocol

+ Expand

Quantitative assessment of mitochondrial DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

A quantitative polymerase chain reaction (qPCR) was performed on representative technical replicates to validate relative amounts of mitochondria between samples. A qPCR was performed according to vendor protocol with iTaq Universal Sybr green reagent (Bio-Rad) on 5 ng of mtDNA per sample for NADH dehydrogenase subunit 1 (mtND1; forward primer 5′-CCC ATT CGC GTT ATT CTT-3′ and reverse primer 5′-AAG TTG ATC GTA ACG GAA GC-3′) and mitochondrial ribosomal RNA (mt16S; forward primer 5′-CCG CAA GGG AAA GAT GAA AGA C-3′, and reverse primer 5′-TCG TTT GGT TTC GGG GTT TC-3′). Ct values were compared between samples.

Snoke D.B., Mahler C.A., Angelotti A., Cole R.M., Sparagna G.C., Baskin K.K, & Belury M.A. (2022). Linoleic Acid-Enriched Diet Increases Mitochondrial Tetralinoleoyl Cardiolipin, OXPHOS Protein Levels, and Uncoupling in Interscapular Brown Adipose Tissue during Diet-Induced Weight Gain. Biology, 12(1), 9.

+ Open protocol

+ Expand

Quantitative Analysis of CYC1 Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA and cDNA samples were analyzed on an Agilent 2100 bioanalyzer using the 6000 Nano or Pico Kit, respectively, according to manufacturer's instructions (Agilent Technologies, Waldbronn, Germany). 1.2 μg of total RNA was converted to cDNA using the SuperScript III First-Strand Synthesis System with poly-dT primer extension and final RNase H treatment (Life Technologies). For detecting CYC1 transcripts, cDNA samples were subjected to PCR using the following primers: 5′-region: Forward (FW): 5′-GTCGTCGAAGTCTGGCCTTT-3′, Reverse (RV): 5′-CACGGTGAGACCACGGATAG-3′; Central-region: FW: 5′-GCCTCCTCTCTTCCTTGGAC-3′, RV: 5′-TCTTCATTGGGGCCGTCTTG-3′; 3′-region: FW: 5′-GGCATGGTGGTGAGGACTAC-3′, RV: 5′-CCCATGCGTTTTCGATGGTC-3′. For each sample, 1 μl of the cDNA solution (57 ng total RNA equivalent) was serially diluted 1:10, 1:100, 1:1,000, and 1:10,000, and PCR amplified in a Bio-Rad CFX Connect Real-Time PCR cycler using 0.2 μM primers and the iTaq Universal SYBR Green reagent (Bio-Rad, Hercules, CA).

Sonntag K.C., Tejada G., Subburaju S., Berretta S., Benes F.M, & Woo T.U. (2016). Limited predictability of postmortem human brain tissue quality by RNA integrity numbers. Journal of neurochemistry, 138(1), 53-59.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA of cells and tissue was purified using E.Z.N.A. total RNA kit (Omega Biotek) and reverse transcribed using RevertAid H Minus Reverse Transcriptase (Fermentas). Tissue was homogenized using RNA homogenizer mini columns (Omega Biotek) prior to RNA isolation. qPCR was performed using specific primers (Supplementary Table 3), iTaq Universal SYBR Green reagents (Biorad) and a Biorad CFX Connect Real Time PCR system. Relative gene expression ratios were determined according to the Pfaffl method, using ACTB as a housekeeping gene. In the A549^Δp53 ortotopic xenografts, Bestkeeper values were calculated using human 28S and human TATA box binding protein (TBP), as well as mouse Actb and 28S as reference genes. (49 (link))

Moll H.P., Pranz K., Musteanu M., Grabner B., Hruschka N., Mohrherr J., Aigner P., Stiedl P., Brcic L., Laszlo V., Schramek D., Moriggl R., Eferl R., Moldvay J., Dezso K., Lopez-Casas P.P., Stoiber D., Hidalgo M., Penninger J., Sibilia M., Győrffy B., Barbacid M., Dome B., Popper H, & Casanova E. (2018). Afatinib restrains K-RAS driven lung tumorigenesis. Science translational medicine, 10(446), eaao2301.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse lung tissue was homogenized in TRIzol reagent. Following separation with 1-bromo-3-chloropropane, aqueous phase was collected, and RNA was precipitated with ethanol. Precipitated RNA was isolated and cleaned using NucleoSpin RNA extraction kit (Machery-Nagel, #740955) following the manufacturer’s protocol. cDNA was generated using the iScript cDNA Synthesis Kit (BioRad, #1708890) following the manufacturer’s protocol. mRNA quantification was performed using iTaq Universal SYBR Green reagents (BioRad) on a CFX-384 (BioRad) instrument using Chmp2a as a reference gene. Primers used in this study were acquired from Integrated DNA Technologies and are listed in Supplementary Data 3.

Speaks S., McFadden M.I., Zani A., Solstad A., Leumi S., Roettger J.E., Kenney A.D., Bone H., Zhang L., Denz P.J., Eddy A.C., Amer A.O., Robinson R.T., Cai C., Ma J., Hemann E.A., Forero A, & Yount J.S. (2024). Gasdermin D promotes influenza virus-induced mortality through neutrophil amplification of inflammation. Nature Communications, 15, 2751.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!