Hvsmcs

The human cell line THP-1 and human vascular smooth muscle cells (HVSMCs) were purchased from ATCC (American Type Culture Collection, Nr. TIB-202, Wesel, Germany). The human cell line THP-1 was cultured in RPMI-1640 media (Thermo Scientific, Waltham, U.S.A.) supplemented with 10% fetal bovine serum (PAA) and 100 μM P/S (Sigma-Aldrich). Cells were maintained at densities between 0.5 and 1.0 × 10⁶cells/ml in culture. HVSMCs were grown in medium DMEM/F12 (Gibco. Grand Island, NY) supplemented with 20% fetal bovine serum (PAA) and 100 μM P/S (Sigma-Aldrich). Cells were incubated at 37˚C and 5% CO₂–95% air.
The miR-155 mimic (Thermo Fisher, Waltham, MA, U.S.A.) and miR-155 inhibitor (Exiqon Inc, Woburn, MA, U.S.A.) were transfected into THP-1 cells by using X-treme GENE siRNA transfection reagent (Mirus Bio LLC, Madison, WI, U.S.A.). Cells were transfected with nonsense sequence as controls (mimic NC and inhibitor NC). Inhibitor sequence were as follows: nonsense control (inhibitor NC) GTGTAACACGTCTATACGCCCA (Exiqon; 199020-00) and miR-155 inhibitor sequences were GTGTAACACGTCTATACGCCCA (Exiqon; 428232-00). miR-155 mimic sequences were UUAAUGCUAAUUGUGAUAGGGGU/AM17100 and miR control sequences were AM17111. THP-1 cells were transfected for approximately 48 h before transfection reagents were removed.

Human aortic vascular smooth muscle cells (hVSMCs) were obtained from the American Tissue Culture Collection (Manassas, VA, USA). We cultured the hVSMCs in culture dishes containing a Medium-231 (M231500, Gibco BRL, Grand Island, NY, USA), 10% fetal bovine serum, 1% antibiotic-antimycotic solution (Gibco BRL) and smooth muscle growth supplement (S00725, Gibco BRL). Cells were incubated at 37 °C in a humidified atmosphere containing 5% CO₂.