Pbiozol plant total rna extraction reagent

Total RNA was extracted from leaf, stem, and root tissues using the pBIOZOL plant total RNA Extraction Reagent (BioFlux, Hangzhou, China) according to the manufacturer’s protocol. The integrity of the RNA was verified by 1.5% agarose gel electrophoresis. After removing genomic DNA with gDNA Eraser, approximately 2 μg RNA was used to synthesize the first-strand cDNA using the PrimerScript RT Reagent Kit (Takara Biotechnology, Dalian, China).

Total RNA was extracted from Jatropha leaves using the pBIOZOL Plant Total RNA Extraction Reagent (BioFlux, Hangzhou, China) following the manufacturer’s instructions. Then, first-strand cDNA was synthesized with 1.0 μg of the extracted RNA using the TAKARA PrimeScript^TM RT Reagent Kit (TAKARA, Dalian, China). A 153 bp fragment (TCCGTCAATCAGATGGAGATACGTGCTTAGCTCGTGACATGTGGCCACGTCTCTTTTGTTTAGATACGGTGACTGTTTGCTACTGAGCCTAAGCTCTTGCCCCACCTCAGCATAAACCCACTGCGTGCTCTCTACTCGCTTCTGTAACCAACT) was PCR-amplified from the synthesized cDNA using primers carrying appropriate restriction enzyme cutting sites (all primers used in this study are listed in Supplementary Table S2). The PCR products were subsequently cloned into a pEASY-Blunt Zero cloning vector (TransGen Biotech, Beijing, China) with the appropriate restriction enzymes and sequenced.

Total RNA was extracted from different tissues using pBIOZOL Plant Total RNA Extraction Reagent (BioFlux, Hangzhou, China) according to the protocol; then the extracted total RNA was treated with gDNA Eraser to remove genomic DNA as following the reaction system (5× g Eraser Buffer 2 μL, gDNA Eraser 1 μL, total RNA 1 µg) (Takara Bio, Dalian, China). Next, total RNA (1 µg) was reverse transcribed using the PrimeScriptTM RT kit (Takara Bio, Dalian, China) to obtain cDNA as following reaction system (PrimerScript RT Enzyme Mix I 1 μL, RT Primer Mix 1 μL, 5× PrimerScript Buffer 4 μL, total RNA 1 µg). The quantitative real-time PCR used an UltraSYBR Mixture (Low ROX) (CWBIO) with three biological replicates, and the detailed procedure referred to the manufacturer’s instructions. The RT-qPCR reaction was performed by qTOWER 3G Cycler (Analytik Jena, Germany) and the relative expression level analysis was calculated using 2^−△△CT method [36 (link),37 (link)]. We selected the UBQ7 gene as an internal reference gene [38 (link),39 (link)]. All PtrAPX specific primers for RT-qPCR and UBQ7 gene primers are listed in Supplementary Table S1.

PtrDHN-3 RNA was isolated using pBIOZOL Plant Total RNA extraction reagent (Bioflux, Beijing, China). cDNA was then synthesized from the total RNA using a Reverse Transcription Kit (Takara Japan, Osaka, Japan).
Resistance-related gene sequences in Arabidopsis (SOD1 (NM_100757), SOD2 (NM_101123), SOD3 (NM_128379), POD1 (NM_102257), POD2 (NM_127371), POD3 (NM_127372), P5CS1 (NM_129539) and P5CS2 (NM_115419)) were download from https://www.arabidopsis.org/ (accessed on 15 November 2020). PtrActin (Potri.001G453600) and AtActin (At5G09810) were used as internal controls in P. trichocarpa and Arabidopsis, respectively. All primers used for qRT-PCR are shown in Supplementary Table S1.
Takara quantitative PCR enzyme (Takara Japan) was used for the qRT-PCR reactions, all of which were performed in triplicate as follows: 94 °C for 30 s followed by 45 cycles of 94 °C for 12 s, 58 °C for 30 s and 72 °C for 45 s. Detection was carried out using the Roche LightCycler 480 II (Jena q Tower 3G, Jena, Germany), and relative abundance was determined based on the 2^−ΔΔCT method [45 (link)]. All experiments were conducted with three biological replicates.