Each sample and negative control was measured in triplicate. For each well on a 96-well qPCR plate (Applied Biosystems, USA), 5 μl of Sybr Green (SensiFAST SYBR Hi-ROX kit, Bioline, UK), 0.5 μl each of 10 μM forward and reverse primers (Table 1 ) diluted 1:10 in nuclease free water, and 3 μl of nuclease free water (Qiagen, Belgium) was added to a 500 μl microfuge tube. 9 μl of this mastermix was added to each well, along with 1 μl of sample cDNA. Amplification was performed with the following program: 1 cycle at 95 ˚C for 2 min, 50 cycles at 95 ˚C for 5 s and 60 ˚C for 30 s, 1 cycle at 95 ˚C for 15 s, 60 ˚C for 1 min, and 95 ˚C for 15 s. Non-POU domain-containing octamer binding protein, encoded by Nono, was used as the internal fat-specific housekeeping gene [32]. Values were expressed as a 2-ΔΔCt average for each sample, as previously described (33 (link)). Mean and SEM were then calculated for each group of mice.
Nuclease free water
Manufactured by Qiagen
Sourced in Germany, United States, United Kingdom, France, Belgium, Japan
Nuclease-free water is a high-purity water product specifically designed for laboratory applications. It is free of detectable RNase, DNase, and other nucleases, ensuring the integrity of nucleic acid samples during various experimental procedures.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (11 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (10 mentions)
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
Rneasy kit, by Qiagen (8 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (8 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (8 mentions)
Rnalater, by Thermo Fisher Scientific (6 mentions)
Nanodrop, by Thermo Fisher Scientific (6 mentions)
2100 bioanalyzer, by Agilent Technologies (5 mentions)
Mach1, by Thermo Fisher Scientific (4 mentions)
Iscript cdna synthesis kit, by Bio-Rad (4 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (4 mentions)
Qiaamp viral rna mini kit, by Qiagen (3 mentions)
Protease inhibitor mix, by Merck Group (3 mentions)
Reducing agent, by Thermo Fisher Scientific (3 mentions)
Rnaseout, by Thermo Fisher Scientific (3 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Rnaclean xp, by Beckman Coulter (3 mentions)
Tri reagent, by Merck Group (3 mentions)
Nanodrop one spectrophotometer, by Thermo Fisher Scientific (3 mentions)
181 protocols using nuclease free water
1
Quantifying Gene Expression via qPCR
2
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was prepared for each sample using the RNeasy Mini Kit (QIAGEN, Cat. No. 74104, Mississauga, Canada), and genomic DNA was eliminated by loading RNase-free DNase I into the filter column (QIAGEN). Nucleic acid extraction was performed according to the manufacturer's instructions. The quality of the RNA was checked by electrophoresis on 1% agarose gels to reveal any contaminating genomic DNA and intact rRNA subunits 28S and 18S. Nucleic acid concentrations were measured using a Nanodrop 1000 (Thermo Scientific, Wilmington, DE, USA).
First-strand cDNA was synthesized using random hexamer primers and SureStart Taq DNA polymerase according to the manufacturer's instructions (Agilent Technologies, Cat. No.20820, Santa Clara, CA, USA). To avoid errors caused by contamination with genomic DNA, all RNA samples were treated with RNase-free DNase I before reverse transcription (Agilent Technologies, USA). One microgram of total RNA was used for cDNA synthesis; the cDNA was subsequently diluted with nuclease-free water (QIAGEN) to 20 ng/μL. The cDNA mixtures were diluted 1:10 with nuclease-free water (QIAGEN) and stored at −20 °C for subsequent quantitative PCR analysis.
First-strand cDNA was synthesized using random hexamer primers and SureStart Taq DNA polymerase according to the manufacturer's instructions (Agilent Technologies, Cat. No.20820, Santa Clara, CA, USA). To avoid errors caused by contamination with genomic DNA, all RNA samples were treated with RNase-free DNase I before reverse transcription (Agilent Technologies, USA). One microgram of total RNA was used for cDNA synthesis; the cDNA was subsequently diluted with nuclease-free water (QIAGEN) to 20 ng/μL. The cDNA mixtures were diluted 1:10 with nuclease-free water (QIAGEN) and stored at −20 °C for subsequent quantitative PCR analysis.
3
Optimized RNA Extraction from Stool
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protocol of Zoetendal et al. [12 (link)] was used with a reduced amount of starting material. Instead of 15 g stool, 150 mg of the stool sample were used for RNA isolation, the same amount as applied for the commercial kits. After pretreatment of the stool samples (see above) the Zoetendal protocol was followed. Briefly, the samples were centrifuged (11.000 g, 1 min, RT) after bead beating 3 times (45 s, 5.5 m/s) using a Fast Prep instrument, and the upper aqueous phase was used for phenol/chloroform extraction. The extractions were repeated until the interphase appeared clear. Subsequently an on-column DNAse I digestion using the Qiagen RNEasy Kit was performed. The RNA was washed on the column (according to the RNEasy Mini kit procedure), the column dried (11000 g, 1 min, RT) and the RNA eluted in 60 μl of nuclease free water (Qiagen, Germany). An overnight ethanol precipitation with 1/10 volume 3 M sodium acetate (Life Technologies, Germany), 3 volumes ethanol (Roth, Germany) and 1/100 volume glycogen (Life Technologies, Germany) was carried out. The precipitated RNA was washed 2 times with 70 % ethanol and resuspended in 100 μl of nuclease free water (Qiagen, Germany).
4
Quantifying C. elegans Motility
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To score C. elegans motility, L4 staged worms were gently transferred by pick to 30 µL of nuclease-free water (Qiagen) in an 18-well uncoated slide (Ibidi 81821) with two worms/well. Fifteen minutes after the last worm was transfered, the number of head movements to the right per 30 sec was counted under a bright light microscope. Room temperature was monitored closely and maintained within 21°C–23°C. Worms for each experiment were processed and analyzed in parallel as small temperature changes alter locomotion, by a single-blind observer. No more than three strains were analyzed in parallel to ensure consistency. Worm health was verified by touch response to the pick; unreactive worms were excluded.
5
RT-PCR Detection of Viral Fragments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymerase chain reaction (PCR) was performed on the synthesized cDNA with two pairs of primers PPRVF1b: [ 5′AGTACAAAAGATTGCTGATCACAGT 3′]
PPRVF2d: 5′GGGTCTCGAAGGCTAGGCCCGAATA 3′ and NP3 (5′-TCTCGGAAATCGCCTCACAGACTG-3′) and NP4 (5′-CCTCCTCCTGGTCCTCCAG AATCT-3′) which target 448 and 351 bp fragments, respectively, as previously described (13 (link), 14 (link)).
The PCR reaction was performed in a 20 μl reaction containing 10 μl Taq DNA Pol 2.0X MyTaqRedMix (Bioline, UK), 1 μl (10 μM) of each primer, 3 μl of cDNA and 5 μl of nuclease-free water (Qiagen, USA). The mixture was then subjected to an initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 2 min and final extension at 72°C for 7 min. Amplification was performed in a S1000 ™ Thermal Cycler [BIO RAD, California, United states]. Ten microliter of each PCR amplicon were resolved on a 2% ethidium bromide-stained agarose gel as previously described (14 (link)–16 ).
PPRVF2d: 5′GGGTCTCGAAGGCTAGGCCCGAATA 3′ and NP3 (5′-TCTCGGAAATCGCCTCACAGACTG-3′) and NP4 (5′-CCTCCTCCTGGTCCTCCAG AATCT-3′) which target 448 and 351 bp fragments, respectively, as previously described (13 (link), 14 (link)).
The PCR reaction was performed in a 20 μl reaction containing 10 μl Taq DNA Pol 2.0X MyTaqRedMix (Bioline, UK), 1 μl (10 μM) of each primer, 3 μl of cDNA and 5 μl of nuclease-free water (Qiagen, USA). The mixture was then subjected to an initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 2 min and final extension at 72°C for 7 min. Amplification was performed in a S1000 ™ Thermal Cycler [BIO RAD, California, United states]. Ten microliter of each PCR amplicon were resolved on a 2% ethidium bromide-stained agarose gel as previously described (14 (link)–16 ).
6
Quantification of Zika Virus RNA
7
Transcriptional and Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transcriptional assays at individual loci using RT- and RT-qPCR were carried out essentially as in [34 (link)]: primer sequences are listed in Additional file 1 : Table S1. Protein was extracted from cells growing in log phase using protein extraction buffer (50 mM Tris–HCl, 150 mM NaCl, 1% Triton-X, 10% glycerol, 5 mM EDTA; all Sigma-Aldrich) and 0.5 µl protease inhibitor mix (Sigma-Aldrich). For Western blotting, 30 μg protein was denatured in the presence of 5 μl 4× LDS sample buffer (Invitrogen) and 2 μl 10× reducing agent (Invitrogen) in a total volume of 20 μl nuclease-free water (Qiagen) via incubation at 70 °C. Proteins were separated by SDS-PAGE and then electroblotted onto a nitrocellulose membrane (Invitrogen) and blocked in 5% non-fat milk for 1 h at room temperature (RT). Membranes were incubated with anti-DNMT1 (a kind gift from Guoliang Xu) and anti-β-actin (Abcam ab8226) overnight at 4 °C, followed by HRP-conjugated secondary antibody incubation at RT using ECL (Invitrogen).
8
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the RNeasy kit (Qiagen, Crawley, UK), according to the manufacturer’s instructions. For cDNA synthesis, 300–500 ng RNA was used in combination with 0.5 μg random primers (Roche, West Sussex, UK), 40 U RNaseOUT 0.5 μM dNTPs (Invitrogen, Paisley, UK) 1× RT Buffer (Fermentas, Cambridge, UK) and RevertAid reverse transcriptase (Fermentas, Cambridge, UK) made up to a final volume of 20 μl using RNase-free water (Qiagen, Crawley, UK). Reactions were carried out in a thermocycler with conditions—25 °C for 10 min, 42 °C for 60 min and 70 °C for 10 min. One microlitre cDNA per well on a 96-well plate (Roche) was used for RT-qPCR with SYBR Green reagent and remaining cDNA stored at −80 °C. RT-qPCRs were performed using a LightCycler 480 Instrument II (Roche, West Sussex, UK). Gene expression was normalised to Hprt and relative expression calculated by the ΔΔCT method [40 (link)]. Each RT-qPCR contained 1× buffer, 0.4 mM dNTPs, 50 μM primers (Additional file 1 : Table S1), 0.01 U Taq DNA polymerase (Invitrogen, Paisley, UK) and nuclease-free water (Qiagen, Crawley, UK). Four primer sets for Dnmt1, Dnmt3a, Dnmt3b [47 (link)] and Hprt [13 (link)] were used. The general thermocycler conditions are as follows—94 °C for 3 min, followed by 30 cycles of 94 °C for 30 s, 63 °C for 1 min, 72 °C for 1 min with a final elongation step of 72 °C for 4 min.
9
ERIC-PCR for Strain Identification in C. pseudotuberculosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To identify related strains and distinguish between distinct strains, selected isolates of C. pseudotuberculosis were subjected to ERIC-PCR using the primer sequences ERIC1: 5´-ATGTAAGCTCCTGGGGATTCAC 3´ and ERIC2: 5´-AAGTAAGTGACTGGGGTGAGCG-3´ as described by Versalovic et al. (1991) (link). The ERIC-PCR was carried out in a total volume of 25 µl. Each reaction was made of 12 µl of hot start premix (Genedirex, Taiwan), 1 µl of each primer (10 pmol), 2 µl of sample DNA (30–100 ng/l), and 9 µl nuclease-free water (Qiagen, Germany). According to the PCR program used by Bakhshi et al. (2018) (link), the reaction was carried out using the 9700 GeneAmp PCR system (Applied Biosystems, USA) as follows: initial denaturation for 5 minutes at 94°C followed by 35 cycles of repeated steps of denaturation at 94°C for 1 minute, annealing at 54°C for 1 minute, extension at 72°C for 5 minutes, and final extension at 72°C for 10 minutes. On a 1% agarose gel with Prime Safe Dye (GeNet Bio, Korea) at 70 volts for 10 minutes and later at 80 volts for 1 hour, the PCR products were visualized. The GelJ gel analysis program (v. 2.0) was used to analyze the results of ERIC-PCR. The DICE similarity coefficient and a position tolerance of 1.0 were used in the unweighted pair group method with arithmetic averages (UPGMA) approach to create the dendrogram (Heras et al., 2015 ).
10
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared and extracted mechanically for each sample using the RNeasy Mini Kit (QIAGEN, Cat. No 74104, Mississauga, Canada)according to the manufacturer’s instructions. The quality of the RNA was evaluated by 1% agarose gel electrophoresis to indicate the intact28S and 18S ribosomal RNA (rRNA) subunits without any contaminating genomic DNA. Nucleic acid concentrations were measured using a Nanodrop 1000 (Thermo Biotech, USA).
First-strand cDNA was synthesised using the PrimeScript™ RT reagent Kit with gDNA Eraser according to the manufacturer’s instructions (Takara, Cat.No.RR047A, China). Before the reverse transcription, RNase-free DNase I(Agilent Technologies, USA)was added immediately into the RNA samples in order to avoid potential errors from genomic DNA contamination. One μg total RNA was used for the cDNA synthesis. Subsequently, the cDNA was diluted into 20 ng μl-1with nuclease-free water(QIAGEN, Canada). The cDNA mixtures were diluted 1:10 with nuclease-free water and stored at -20°C for subsequent qPCR analysis.
First-strand cDNA was synthesised using the PrimeScript™ RT reagent Kit with gDNA Eraser according to the manufacturer’s instructions (Takara, Cat.No.RR047A, China). Before the reverse transcription, RNase-free DNase I(Agilent Technologies, USA)was added immediately into the RNA samples in order to avoid potential errors from genomic DNA contamination. One μg total RNA was used for the cDNA synthesis. Subsequently, the cDNA was diluted into 20 ng μl-1with nuclease-free water(QIAGEN, Canada). The cDNA mixtures were diluted 1:10 with nuclease-free water and stored at -20°C for subsequent qPCR analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!