Sybr green master mix

Total RNA were extracted from HUVEC, EA.hy926 cell and rabbit’s plasma upon treatment completion using TRIzol. The RNA extraction procedure was performed accordingly to manufacturer’s protocol. Following successful extraction, the total RNA was reverse transcribed using the PrimeScript RT reagent Kit (Takara). The resultant cDNA was used for qRT-PCR reactions which were performed using SYBR-Green Master Mix (Takara) at a total volume 10 μl, comprised of 100 ng cDNA as template, 0.2 μM each primer, and 1 × SYBR-Green Master Mix. The amplification procedure was as follow: Initial denaturation at 95 °C for 30 s, next performed 40 cycles of 95 °C for 5 s, 58 °C for 15 s and 72 °C for 15 s, and a final extension at 94 °C for 15 s. The target gene expression data was analyzed with the 2^-ΔΔCq method [19 (link)]. The primer sequences used were as follows: 5′-ATATGGCAAAAGCGGACAAG-3′ (forward) and 5′-GCAACATCACCAATGGACAG-3′ (reverse) for HMGB1; 5′-AGAAACTGCTCGGTCAGACG-3′ (forward) and 5′- AATGGAATCGGGGTGAAGGG − 3′ (reverse) for TLR4; 5′-AGTCCGGGCAGGTCTACTTT-3′ (forward) and 5′-GGCCACTACTTCAGCGTCTC-3′ (reverse) for TNF-α; 5′-GTCCGGAGAGGAGACTTCAC-3′ (forward) and 5′-ACAGTGCATCATCGCTGTTC-3′ (reverse) for IL-6; 5′-ACAGCAATGGTCGGGACATA-3′ (forward) and 5′-TGAGAGACCTGACTTGGCAG-3′ (reverse) for IL-1β; 5′-CCAGGTGGTCTCCTCTGA-3′ (forward) and 5′-GCTGTAGCCAAATCGTTGT-3′ (reverse) for GAPDH.

Several DEGs involved in flower development of Lei bamboo were chosen for validation with quantitative real-time PCR (qRT-PCR). qRT-PCR reaction was analyzed with the CFX96TM real-time PCR detection system (Bio-Rad, Hercules, USA) with the SYBR Green Master Mix (Takara, Dalian, China), and amplified with 1 ul of cDNA template, 10 ul of 2 x SYBR Green Master Mix, and 1ul of each primer (10 umol/ul), to a final volume of 20 ul by adding water. The amplification program consisted of 1 cycle of 95 °C for 30s, followed by 39 cycles of 95 °C for 5 s, TM for 20s, 72 °C for 20s. The Actin was used as reference gene. All the qPCR assays were performed with three biological and four technical replicates, and the quantitative analysis used the 2^-ΔΔCT method.

The relative expression levels of ScADH3 under different exogenous stresses were detected using qRT-PCR. Beacon Designer 8.12 software was employed to design the qRT-PCR primers of ScADH3. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was selected as the reference gene [78 , 79 (link)]. The qRT-PCR reaction system (SYBR Green Master Mix: 10 μL, 10 μM forward and reverse primers: 0.8 μL, 20 × diluted cDNA template: 1.0 μL, and sterile distilled water: 7.4 μL) was constructed with reference to the manual of SYBR Green Master Mix (TaKaRa). The reaction procedure was as follows: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The 2^-ΔΔCt method was used to normalize the relative expression level of qRT-PCR data [80 (link)]. Each of the samples had three biological replicates. Three technical replicates were performed. All primers used in qRT-PCR are listed in Supplementary Table S8. Data Processing System v9.50 software (China) was used to conduct the statistical analysis. Data were expressed as the mean ± standard error (SE), Significance (p < 0.05) was calculated using one-way ANOVA, followed by Duncan’s new multiple range test.

The sequences of the genes used for qRT-PCR validation were provided (details listed in Supplementary Data Sheet S1). Gene-specific primers (Supplementary Table S1) were designed using Primer3² Total RNAs were extracted from leaves and from sepals, petals, stamens, and pistils at 8–10 mm flower buds development stage using TRIzol RNA purification kit (TaKaRa, China). One microgram of total RNA was used in reverse transcription in a total reaction volume of 20 μL in the presence of 6-mer random primers and an oligo primer according to the protocol provided by manufacturer TaKaRa (Yan et al., 2011 (link)). The standard curve for each gene was obtained by real-time PCR with five dilutions of cDNA. The reactions were performed in 20 μL volumes each containing 10 μL 2× SYBR Green Mastermix (TaKaRa), 300 nM of each primer and 2 μL of 10-fold diluted cDNA template (Yan et al., 2014 (link)). The PCR reactions were run in a Bio-Rad Sequence Detection System. Three biological replicates were performed for each analysis. RhGAPDH (AB370120) was used as control. Quantification of gene relative expression in different organs was performed using the delta-delta Ct method as described by Livak and Schmittgen (2001) (link). All data were expressed as the mean ± standard deviation (SD) after normalization.

TRIzol reagent (Invitrogen, USA) was used to extract total RNA inaccordance with the manufacturer's instructions which was then reverse transcribed into cDNA using an NEB reverse transcription kit (Thermo Fisher Scientific, USA). qPCR was performed with a 2 × SYBR Green master mix (Takara, Japan) using a 7500 Real-Time PCR System (Applied Biosystems). The qPCR primer sequences are listed in Table 2. Changes in gene expression in both cells and tissue samples were calculated using the 2 ^-ΔΔCt method.

The transcriptional levels of Hc-cap-15 during the entire developmental period of H. contortus, including eggs, L1s, L2s, L3s, female L4s (L4F) and male L4s (L4M), female adults (AF) and male adults (AM), were determined by real-time PCR. Briefly, total RNA was extracted from the samples at each developmental period (40,000 eggs, 20,000 L1s and L2s, 10,000 L3s, 5 L4s, and 2 adults of each sex) by using TRIzol reagent (Invitrogen, Thermo Fisher Scientific) following the manufacturer’s protocol, and then complimentary DNA (cDNA) was reverse transcribed using the HiScript II Q RT SuperMix (Vazyme). Real-time PCR was carried out using 2× SYBR Green Master Mix (Takara, Shiga, Japan), and the mean threshold cycle (Ct) values of Hc-cap-15 were determined with specific primer pair qHc-cap-15-F/R (Additional file 1: Table S2) in a thermal cycler (model ViiA; Bio-Rad Laboratories, Hercules, CA, USA). Hc-β-tubulin was set as the internal reference gene. The cycling protocol comprised 95 °C for 30 s, followed by 35 cycles at 95 °C for 15 s, 60 °C for 15 s and 72 °C for 20 s. The 2^−ΔΔCt method was applied to calculate the relative transcription level (AF = 1) at the different developmental stages of H. contortus [32 (link)].