Maxima sybr green rox qpcr

MCF-7 cells were transfected with appropriate plasmids. Twenty four hours after transfection, the cells were replaced with phenol red-free medium containing 2% charcoal-stripped fetal bovine serum for 24 h, then treated with or without 10 nM E2 for 16 h. Total RNA was isolated from the cells using TRIzol reagent (Takara), and then subjected to reverse transcription with oligo(dT)15. The mRNA levels of ERα, Cyclin D1, GREB1 and GADPH (as an internal control) were quantitated by real-time PCR using Corbett Research RG 3000 analyzer (Australia), Maxima SYBR Green/ROX qPCR (Thermo Scientific). The following primer sequences were used: ERα: 5′-ACTCGCTACTGTGCAGTGTGCAAT (forward) and 5′-CCTCTTCGGTCTTTTCGTATCCCA (reverse); Cyclin D1: 5′-GCTGCTCCTGGTGAACAAGC (forward) and 5′-AAGTGTTCAATGAAATCGTGCG (reverse); GREB1: 5′-CAGGCTTTTGCACCGAATCT (forward) and 5′-CAAAGCGTGTCGTCTTCAGCT (reverse); GADPH: 5′-GGGTTGAACCATGAGAAGT (forward) and 5′-GACTGTGGTCATGAGTCCT (reverse). The mRNA levels of ERα, Cyclin D1 and GREB1 were normalized against GAPDH, which served as an endogenous control. Each gene was measured in triplicate.

Measurements in gene expression were performed by quantitative RT-qPCR using RNA samples extracted from third and fourth true leaves. The process of RNA extraction was adapted from Valledor et al. [51 (link)]. Samples were treated with DNAse I (Takara) following the manufacturer’ instructions. To obtain cDNA, 1.5 µg of RNA was annealed to oligo-dTs, and retrotranscription was performed with a PrimeScript RT reagent kit (Perfect real-time) from Takara. RT-qPCR was conducted using Maxima SYBR Green/ROX qPCR (Thermo Scientific) on a StepOne instrument (Applied Biosystems). For optimum amplification efficiency, a standard curve through serial dilutions of cDNA was constructed. Specificity of RT-qPCR amplification was tested by looking for a single peak in the melting temperature curve analysis. Relative quantification of mRNA levels was calculated using the comparative $2_{\text{T}}^{-\mathrm{\Delta }\mathrm{\Delta }C}$ method [52 (link)]. For normalization of expression values, two housekeeping genes were used: the tomato elongation factor EF-1 (fw- 5′-GATTGGTGGTATTGGAACTGTC-3′; rev- 5′-AGCTTCGTGGTGCATCTC-3′) and the tomato ACT-52 gene (fw- 5′-CACCATTGGGTCTGAGCG-3′; rev- 5′-GGGCGACAACCTTGATCT-3′). Relative expression data between the studied gene PROSYS (fw- 5′-AATTTGTCT CCCGTTAGA-3′; rev- 5′-AGCCAAAAGAAAGGAAGCAAT-3′) and the housekeeping genes were calculated from the differences in threshold cycle (∆Ct).

Total RNA was extracted from GC cells with Total RNA Extractor (B511311; Sangon, Shanghai, China) and the purity was determined by NanoDrop™ One/OneC UV-Vis Spectrophotometer (701-058112; Thermo Fisher Scientific, Inc.). Then, 1 µg RNA was reversely transcribed into complementary DNA (cDNA) with Thermo Scientific RevertAid RT kit (K1691; Thermo Fisher Scientific, Inc.). Subsequently, the cDNAs were subjected to qRT-PCR with the specific primers of SIRT1, APE1, or p53 using Maxima SYBR Green/ROX qPCR (K0223, Thermo Fisher Scientific, Inc.) in the Mx3005P system (Agilent Technologies, Inc., CA, USA). The expressions of SIRT1, APE1, and p53 were calculated and determined using the 2^−ΔΔCt method with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the normalization control [33 (link)]. The reaction conditions of PCR were as follows: 10 min at 95°C and then 40 cycles of 15 s at 94°C, 30 s at 58°C, and 15 s at 72°C. The sequences of primers are shown in Table 1.

Total RNA was isolated by TRIzol, reverse-transcribed to synthesize cDNA utilizing PrimeScript RT Reagent Kit (Takara Biomedical Technology (Beijing) Co., Ltd.). qRT-PCR was performed using Maxima SYBR Green/ROX qPCR (Thermo Fisher Scientific). Fold change was calculated by 2^−ΔΔCt. Primers (5’-3’) are as follows: PHLPP1 (NM_194449.4): F: TGTGCCTGAGTGGGTATGTG, R: CATCAGAAGGTTAGGTGGGAG; PHLPP2 (NM_015020.3): F: TACCTGCCTTATCGTTTC, R: GAGTATTGCCGTCGCTTC; ACTB (NM_001101.5): F: GTCACCAACTGGGACGACAT, R: TAGCAACGTACATGGCTGGG. mRNA expression levels were quantified with ACTB as the reference gene. The PCR cycling conditions were as follows: 95 °C for 10 min; followed by 40 cycles at 95 °C for 15 s and 60 °C for 45 s; and a final extension step of 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s and 60 °C for 15 s.