Qiaamp dna kit

Two primers (csp_F, gltX_R) specific for bacterial genes of cold‐shock DNA‐binding domain‐containing protein (csp) and glutamyl‐tRNA synthetase (gltX) and two primers amplifying the 1 kbp integrase gene (int_F and int_R) of the phage were designed (Table 2) based on the phage attachment sites (attP) identified from phage S1249 and the bacterial attachment site (attB) identified from A. actinomycetemcomitans (C. Chen et al., 2009 (link); Resch et al., 2004 (link)). The chromosome DNA of D11S‐1 was extracted from overnight growth of one colony in 5 ml TSBYE using the QIAamp DNA kit (Qiagen) and prepared for PCR. Briefly, a total 5 ml culture of approximately 10⁹ cells was pelleted and resuspended in 180 μl of buffer ATL, mixed with proteinase K and incubated at 56°C overnight with occasional vortexing. The digested samples were added to 200 μl buffer AL, incubated at 70°C for 10 min, and subjected to the standard protocol using spin columns to isolate DNA. The phage DNA was isolated from the filtered spent medium of D11S‐1 after 6 h of growth in 50% human serum using the QIAamp DNA kit (Qiagen) following the protocol of DNA purification from blood or body fluid. Multiplex single colony PCR was also performed using four primers (csp_F, gltX_R, int_F, and int_R) at the same time to locate the phage DNA in the bacterium.

Rectal tumor tissue samples harvested during surgery were submerged in an appropriate volume of RNAlater (Qiagen, Valencia, California, USA) After RNAlater removal the samples were frozen at −80 °C until DNA extraction. QIAamp DNA Kit (Qiagen, Valencia, California, USA) was used for the DNA extraction, following the manufacturer’s instructions. After resection of the tumor, the pelvis was washed with sterile water 200–600 ml (discarded) subsequently followed by 200–600 ml saline water. Two specimens (lavage A and B) of 50 ml lavage fluid were aspirated to centrifuge tubes. Cells were harvested by centrifugation at 1200G for 10 min followed by removal of the supernatant. The cell pellets were frozen at −20 °C until DNA extractions were performed. QIAamp DNA Kit (Qiagen, Valencia, California, USA) was used for the DNA extraction, following the manufacturer’s instructions.

LoxP was inserted on both sides of exon 3 and exon 5 of Pig-a gene to construct the target vector (Fig. 1A), and after verification, plasmid extraction and linearization were performed. The target vector was electrically transferred to embryonic stem cell (ESC) of C57BL/6N mice, and neomycin was added to select drug-resistant clones. The ESCs were verified by PCR, karyotype analysis and Southern Blot. The obtained positive ESCs were microinjected, and the injected blastocysts were transplanted into the pseudo-pregnant female mice. The offspring mice were numbered 1 week after birth, and the 1 cm tails of the mice to be tested were cut off 3 weeks after birth and genomic DNA was extracted with QIAamp DNA kits (Qiagen, 51304). Pig-a genotype was identified by PCR (primer sequences are shown in Table 1). The genotype of Flox homozygous female mice was Pig-a [Flox/Flox], and the genotype of Flox homozygous male mice was Pig-a [Flox/Y].Fig. 1

A schematic diagram of established a Pig-a CKO mice model mediated by Vav-iCre. A ES target strategy. B Propagation strategies. C Photos of offspring mice

Table 1

Specific PCR primers of Pig-a, Vav-iCre

Name	Sequence (5′ to 3′)
Pia-a	Forward, GACTTCTGAACAAAATGAAGGCAGT
	Reverse, GTGCACAGCTGATTAGAAATCTAGG
Vav-iCre	Forward, GGTGTTGTAGTTGTCCCCACT
	Reverse, CAGGTTTTGGTGCACAGTCA

The DNA was extracted using QIAamp DNA Kits (Qiagen) as per the manufacturer’s protocol for Gram-negative bacteria. The DNA concentrations and purity were determined using a Nanodrop^® spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, U.S.). Strains were stored at −80 °C in brain heart infusion broth (BHI) with 40% (v/v) glycerol for future reference [10 ].

Two SNPs in exons, including the rs2071676 (+201, G/A) in exon 1 and the rs3829078 (+1081, A/G) in exon 7, and one SNP in 3′-UTR of exon 11, the rs1048638 (+1584, C/A), were selected due to their dominant effects in other neoplasms [19 (link),26 (link),27 (link),28 (link)]. The genotyping procedure of CA9 SNPs was also used in a manner that has already been established [19 (link)]. Firstly, the DNA was extracted from the leukocytes of the venous blood sample using QIAamp DNA kits (Qiagen, Valencia, Valencia, CA, USA) according to the manufacture’s instruction. Then the allelic discrimination of the selected three CA9 SNPs involving rs2071676 (G/A), rs3829078 (A/G), and rs1048638 (C/A) was evaluated via the usage of a ABI StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The results of real-time PCR were analyzed by SDS version 3.0 software (Applied Biosystems, Foster City, CA, USA).

Four AURKA SNPs, namely rs1047972 (C/T), rs2273535 (T/A), rs6024836 (A/G), and rs2064863 (T/G), were selected due to their considerable effects on other malignancies [16 (link),17 (link),18 (link)]. Regarding genotyping, DNA was first extracted from the leukocytes of venous blood samples from each participant using the QIAamp DNA kits (Qiagen, Valencia, Valencia, CA, USA) according to the manufacturer’s instructions. Subsequently, the allelic discrimination of the four AURKA SNPs was surveyed using the ABI StepOne Real-Time polymerase chain reaction (PCR) system (Applied Biosystems, Foster City, CA, USA). The findings of the real-time PCR were then analyzed using a Safety Data Sheet v3.0 (Applied Biosystems, Foster City, CA, USA) through the TaqMan assay technique to enhance PCR integrity.

Four SNPs, rs2032582 (ABCB1 G2677T), rs1045642 (ABCB1 C3435T), rs4148330 (ABCC1 G-260A), and rs2231142 (ABCG2 C421T), were selected according to the following criteria: a minor allele frequency of the SNP greater than 0.1 in dbSNP and the SNP had been reported to affect expression/function of the ABC transporter or had been associated with cancer risk/clinical outcome in prior studies. Genomic DNA was extracted from pancreatic tissues or cells using QIAamp DNA kits (Qiagen, Valencia, CA, USA). Polymorphisms were detected with TaqMan SNP genotyping assays on a 7900HT Fast Real-Time PCR machine (Applied Biosystems/Life Technologies, Grand Island, NY, USA). The allelic discrimination analysis was verified with the real-time PCR results to ensure the genotyping accuracy.