Genomic tip 20 g

For extraction of genomic DNA, D. flagrans was grown on CM-agar for 7 days. Spores were collected in 100 ml CM liquid medium and incubated at 28°C for 24 h at 180 rpm. Protoplasts were generated as described above and genomic DNA was extracted using Genomic DNA Buffer Set (Qiagen) and Genomic-tip 20/G (Qiagen) according to the manufacturer’s instruction. In total 12 μg of DNA were sent for sequencing.
The D. flagrans genome was sequenced using the PacBio RS technology (Pacific Biosciences, Menlo Park, CA, USA) with libraries prepared with the SMRTbell template prep kit 1.0 (Pacific Biosciences). The sequencing runs and assembly of the libraries were carried out by GATC biotech (Konstanz, Germany). The Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under the accession SAEB00000000. The version described in this paper is version SAEB01000000. Raw reads were deposited at SRA under the accession SRR8400569.

The cultivation of bacteria from organ specimens was performed on cysteine heart agar at 37 °C with 5% CO₂ for 48 h. DNA for whole-genome sequencing was prepared from a 10 mL culture in brain heart infusion broth. Bacterial cells were harvested after 72 h by centrifugation, and the DNA was purified using QIAGEN Genomic-tip 20/G and a QIAGEN Genomic DNA buffer set kit (Qiagen, Hilden, Germany). The DNA quality was examined using a Qubit 2.0 fluorometer (Life Technologies, Germany) and agarose gel electrophoresis.

Yeast genomic DNA was isolated from 1 x 10⁹ cells using Genomic-tip 20/G (QIAGEN) as described in [54 (link)]. After digestion with the BglII restriction enzyme (New England Biolabs) half of the purified DNA was subjected to Neutral-Neutral two-dimensional gel analysis as described in [55 (link)]. Southern blotting was carried out with the probes shown in Fig 2C, which were generated by PCR using genomic DNA as template. Probe 1 was generated as described above. For probe 2, recognizing the BglIIA fragment 5’-GTTTCTTTTCCTCCGCTT-3’ and 5’-ATCTCTTGGTTCTCGCAT-3’ were used as forward and reverse primers, respectively. For the probe near TER102 on chr. I 5’-GAAGGTTCAACATCAATTGATTGATTCTGCCGCCATGATC-3’ and 5’- GCTTCCCTAGAACCTTCTTATGTTTTACATGCGCTGGGTA-3’ were used as forward and reverse primers, respectively.
For Neutral-Alkaline two-dimensional gel electrophoresis BglII digested DNA was run on a Neutral gel in the first dimension. In the second dimension the excised DNA was run on a 1.5% agarose gel in 50 mM NaOH plus 1 mM EDTA at 4°C [7 (link)]. Probe 3 (Fig 2C) used for southern blotting was made by PCR with 5’-CAGCCATAAGACCCCATC-3’ and 5’-GCAGTTGGACGTGGGTTA-3’ as forward and reverse primers, respectively, and genomic DNA as template.

Hybrid assembly was performed using short-read Illumina MiniSeq (Illumina) and long-read Nanopore MinION (Oxford Nanopore Technologies). WGS of strain KUHS13 was performed using a MiniSeq system (Illumina) with a High Output reagent kit (300 cycles). The library for sequencing (insertion size, 500 to 900 bp) was prepared using a Nextera XT DNA library prep kit (Illumina). On the other hand, the DNA library for Nanopore MinION was prepared using a rapid barcoding kit (SQK RBK-004; Oxford Nanopore Technologies) from total DNAs extracted using a Qiagen Genomic-tip 20/G or Gentra Puregene yeast/bacteria kit (Qiagen, Hilden, Germany) and then sequenced on a MinION flow cell (R9.4.1). WGS statistics are shown in Table S1 in the supplemental material. Raw data sets from the Nanopore MinION assay were submitted to Porechop (v0.2.3). The reads were assembled de novo using Canu (v1.8) (30 (link)). After the data were trimmed from Canu, they were polished with Racon (v1.3.1.1) and Pilon (v1.20.1) (31 (link), 32 (link)). The nucleotide sequence of the left end of the linear plasmid (pELF2) was further checked by Sanger sequencing. DFAST and RAST were used to obtain the annotation (33 (link), 34 (link)).

Genomic DNA was isolated using Qiagen Genomic-tip 20/G and Qiagen DNA Buffer Set (Qiagen, Gaithersburg, MD) per the manufacturer's instruction. Eluted DNA was incubated with isopropanol overnight at -80°C and centrifuged 12,000g for 60 min. DNA was washed with 70% ethanol and dissolved in TE buffer. PCR was performed using Ex-taq (Clonetech, Mountain View, CA). Primer sequences for long PCR are: forward, 5’ cccagctactaccatcattcaagtag3’ and reverse, 5'gagagattttatgggtgtaatgcggtg3’. Short PCR was performed using forward primer sequence 5`gcaaatccatattcatccttctcaac3` and the reverse primer sequences same as long PCR. Resultant PCR products were quantified using Pico-green (Life Technologies). Values obtained from the long fragments were normalized using values from short fragments. The lesion frequency per amplicon was then calculated as λ = −ln(AD/AO), where AD/AO is the ratio of amplification of the treated samples (AD) to the amplification of the control samples (AO).