ChIP was performed using the MAGnify Chromatin Immunoprecipitation System (Life Technologies) according to the manufacturer's protocol and using ChIP grade antibodies against Osx (Abcam: ab22552), ZBTB16 (Santa Cruz, PLZF D‐9: sc‐28319), and normal rabbit IgG (Invitrogen).
The purified DNA samples were analyzed by PCR using primers of the proximal ZBTB16 promoter region containing the Sp1 sequence. The primer pairs were as follows: ZBTB16 promoter P1, 5′‐CGCCAGCACTAAAGATGGA‐3′ (forward) and 5′‐CCTCTCTGCTGCGAGGTTAG‐3′ (reverse); ZBTB16 promoter P2, 5′‐ACTGTTTCCACCCAGATTGC‐3′ (forward) and 5′‐ACACCCGTTTTTAGCTGTCG‐3′ (reverse); negative control P3, 5′‐AAGAGTTGCAACATTCCATTCA‐3′ (forward) and 5′‐CTCAGCTTGGTCACCAGGTA‐3′ (reverse); Osx promoter P1, 5′‐TGTCAGTGCGTTCCAGTCTC‐3′ (forward) and 5′‐GCTCCACTCCTGTTCCACTC‐3′; (reverse); and negative control P2, 5′‐AATGGTTCCTGTGGTTCAGC‐3′ (forward) and 5′‐TAAACCCCCTAGGCATCTGG‐3′ (reverse).