To produce virus containing individual sgRNA constructs, HEK293T cells were cultured in DMEM+10% FBS until 70% confluency before transfection. 10 µg of sgRNA plasmid construct, 7.5 µg of pMDLg/pRRE, 2.5 µg of pRSV‐Rev, and 2.5 µg pMD2.G (Addgene #12251, #12253, and #12259), were cotransfected on a 10 cm dish with 50 µL of PEI and 3 mL of Opti‐MEM I Reduced Serum Medium (catalogue no. 31985070, ThermoFisher Scientific). Following overnight incubation, medium was changed to 5% FBS culture. Supernatant were collected twice after 24 and 48 h, respectively. Pooled supernatant were filtered through PES 0.45 × 10−6 m filter and viral particles were concentrated using Lenti‐Pac Lentivirus Concentration Solution (catalogue no. LPR‐LCS‐01, GeneCopoeia) according to manufacturer's instructions. For production of lentivirus particles for generation of stable BNIP‐2 overexpressing H9c2 cells, BNIP‐2 construct was cloned into the pCDH‐CMV‐MCS vector which contains puromycin selection marker. Viral particles were produced in HEK293T cells by cotransfection of pMDLG, pMD2G, PRSV, and pCDH‐CMV‐BNIP‐2 using Viafect (Promega). The supernatant was filtered and harvested after 48 h and used to transduce H9c2 cells.
Lenti pac lentivirus concentration solution
Manufactured by GeneCopoeia
Sourced in United States
Lenti-Pac Lentivirus Concentration Solution is a product designed to concentrate lentiviral particles. It is a reagent that can be used to increase the titer of lentiviral particles, which are commonly used in gene delivery applications.
Automatically generated - may contain errors
Lab products found in correlation
Lenti pac hiv expression packaging kit, by GeneCopoeia (2 mentions)
Polybrene, by Merck Group (2 mentions)
Opti mem 1 reduced serum medium, by Thermo Fisher Scientific (1 mentions)
Viafect, by Promega (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
Polybrene, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Merck Group (1 mentions)
9 protocols using lenti pac lentivirus concentration solution
1
Lentiviral Particle Production and Cell Line Generation
2
Arhgef11 gene knockdown via lentiviral shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four short hairpin RNA (shRNA1-4), targeting different regions of Arhgef11 were cloned into Lenti-Pac HIV Expression Packaging Kit (GeneCopoeia, MD). All four shRNA were specific to rat and one (of four) was a perfect match with human Arhgef11 (S2 Fig
3
Lentiviral Transduction of T293 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
293 T cells were cultured with DMEM supplemented with 10% FBS at 37°C in a humidified atmosphere providing 5%CO2 and 95% air. The pLVX-shRNA1-mDNMT3b plasmids were transduced into the cells with calcium phosphate method when the confluence of T293 cells reached 60%. Observation of fluorescence was considered the confirmation of successful transduction (Figure S3B , supplemental files). 72 hours after packaging, the viral supernatant was collected by centrifugation. The vectors were further purified by using Lenti-Pac Lentivirus Concentration Solution (GeneCopoeia, LT007). qPCR was used to determine the viral titer.
4
Efficient Lentiviral Transduction in HEK 293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1.2 × 107 HEK 293T cells were inoculated in a plate 60 mm in diameter, cultivated at 37°C in a humidified incubator containing 5% CO2, and left to grow overnight. The cells were transfected with a mixture of shRNA vector 4.0 µg, psPAX2 vector 2.0 µg, and pMD2G vector 2.0 µg, using Lipofectamine 2000 according to the manufacturer’s instructions. Transfection efficiency was determined by fluorescence microscope. Briefly, three non-overlapping vision fields were randomly selected, the number of positive cells out of every 100 cells in total was determined, and the corresponding transfection efficiency was then calculated according to the following formula: transfection efficiency = total number of positive cells in THREE vision fields/300 × 100%. The transfection efficiency above 90% was considered as a successful transfection. Supernatant containing lentivirus was harvested 48 and 72 hours after transfection, respectively, using Lenti-Pac™ Lentivirus Concentration Solution (GeneCopoeia, USA), according to the manufacturer’s instructions. Cells were infected with the lentiviruses at Multiplicity of Infection (MOI) of 20. Forty-eight hours after lentivirus infection, puromycin at the concentration of 5 µg/ml was applied to screen stable infected cell lines. Transfection efficiency exceeded 95% in the screened cell lines.
5
Lentiviral Transduction for LUC7L2 Overexpression and Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral pReceiver-Lv242 vector expressing LUC7L2 or control NEG, and a lentiviral psi-LVRU6P vector expressing LUC7L2 shRNA-a, b, c or control shNEG were co-transfected with packaging plasmids (Lenti-Pac HIV Expression Packaging Kit, GeneCopoeia) to 293FT packaging cells. Lentiviral particles were collected after 48 h, and concentrated using Lenti-Pac Lentivirus Concentration Solution (GeneCopoeia). Afterwards, cells were infected by the lentiviral particles separately and then selected using 2 μg/mL puromycin for 2 weeks. NPC cells with stable overexpression or knockdown of LUC7L2 and NEG were constructed.
6
Lentiviral Particle Transduction for Xenograft Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NTR lentiviral particles were concentrated using Lenti-Pac Lentivirus Concentration solution (Genecopoeia, MD, USA). Subcutaneous xenografts were transduced in vivo by intratumoral injection of 8 × 107 TU resuspended in 75 μL of the complete medium supplemented with 5 μg/mL Polybrene (Sigma-Aldrich) when mean tumour volume was 70 ± 25 mm3. A single injection of viral particles per tumour was performed administering the viral suspension throughout the diameter of the tumour.
7
Lentiviral Vector Production for EphA10 CAR T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fully human anti-EphA10 scFv sequence (clone #4) was cloned into the third generation CAR lentiplasmid (pCDH-EF1α-MCS) that utilize the CD28 and 4-1BB stimulatory domains, and CD3ζ signaling domain with restriction enzymes: BstBI and XbaI. For lentiviral vector production, HEK-293T cells were seeded onto 10-cm dishes in a density of 3 × 106 cells/dish. Next day, these cells were transfected with EphA10 CAT vector and lentiviral packaging plasmids (LentiArt pHelp1, LentiArt pHelp2 and LentiArt pHelp3, Creative Biogene, #CART-027CL). Twenty four-hour and 48-h supernatants were collected and centrifugated at 2000g, 4 °C for 10 min to remove cell debris. The lentivirus were then concentrated by using Lenti-Pac Lentivirus Concentration Solution (GeneCopoeia, #LT007) and centrifugation and stored at −80 °C.
8
Lentiviral Transduction of Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The virus particles were generated by transfecting CS-GS241B-mCHER-LV152 and HIV packaging mix in HEK 293Ta lentiviral packaging cell line following the manufacturer’s instructions (GeneCopoeia™, Cat. No. HPK-LvTR-20). The lentiviral particles in the supernatant were harvested 48 and 72 hours post transfection and treated with Lenti-Pac™ Lentivirus Concentration Solution according to the manufacturer’s guideline (GeneCopoeia™, Cat. No. LPR-LCS-01). EP156T, EP156T-AR, 957E/hTERT-AR, EPT3-PT1-AR and LNCaP cells were infected with harvested lentiviral particles combined with polybrene at a final concentration of 8 μg/ml. Used medium was replaced with fresh medium and cells were incubated at 37°C for 48 hours. The infected target cells were grown with 12.5 μg/ml hygromycin and stably transduced EP156T-241B, EP156T-AR-241B, 957E/hTERT-AR-241B, EPT3-PT1-AR-241B and LNCaP-241B cells were selected. In addition, LNCaP cells were transduced with CS-GS241B-mCHER-LV207-01 and CS-GS241B-mCHER-LV207-02 vectors following the same protocol to obtain LNCaP-207-01 and LNCaP-207-02 cells, respectively.
9
Lentiviral Knockdown and Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To establish stable knockdown and overexpression cell lines, the lentiviral vectors pLV-Smad7-inhibitor (target sequence: 5' AAGGTTGCATACTGAGCCAAG 3') and pLV-Smad7-overexpression (NM-005904), along with the packaging plasmid mix, were purchased from Shanghai GenePharma Co., Ltd (Shanghai, China). Individual plasmids and the packaging mix were co-transfected into HEK293TN packaging cell lines using Lipofectamine2000. The culture supernatant was concentrated using the Lenti-pac lentivirus concentration solution (Genecopoeia, Guangzhou, China). The control plasmid provided with the lentivirus kit was processed as described above to obtain the control pseudovirus (sequence: 5' GTCCCGGATACCTAATAAA 3'). HMrSV5 cells were incubated with the lentiviruses in the presence of 2 μg/mL polybrene (Gibco, CA, USA) and were cultured with 2 μg/mL puromycin (Sigma, CA, USA) for at least 96 h to select the stably transfected cells.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!