The largest database of trusted experimental protocols

20 protocols using hu6 mcs ubiquitin egfp ires puromycin

1

Lentiviral Transfection of PRNP

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus of negative control (CON077) and LV-PRNP-RNAi (hU6-MCS-Ubiquitin-EGFP-IRES-puromycin), negative control (CON335) and LV-PRNP (Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin) were constructed by GENECHEM Biotech Co., Ltd. The HESC were digested and uniformly plant in 6-well plate, when the cells were cultured for 24 h, attached to the bottom of flask and grew to confluence of 50%, lentivirus and infection enhance reagent were added into the culture medium, and we exchanged the medium after 12 h of infection. 72 h later, the cells were inspected under the fluorescence microscope and analyzed by qRT-PCR or western blotting assay for evaluating the infection efficiency, then the infected cells were treated by puromycin for 7 days to select out the successfully infected cells.
+ Open protocol
+ Expand
2

Lentiviral Transduction of miR-142a-3p

Check if the same lab product or an alternative is used in the 5 most similar protocols
In this experiment, miR-142a-3p overexpression, knockdown and control groups were constructed using the plasmid hU6-MCS-Ubiquitin-EGFP-IRES-puromycin (Genechem, Shanghai, China). Lentivirus (Genechem) was used to package the plasmid, and finally used to transfect cells. The method is as follows: the vector and the target fragment were each digested with the same restriction enzymes (Beyotime, Shanghai, China) and, after agarose electrophoresis, the gel was cut to recover the product. The recovered vector and the target fragment were ligated overnight at 16°C; the ligation product was used to transform Escherichia coli. The Plasmid Midi Preparation Kit (Beyotime) was used to extract the plasmids.
The cells were planted in a 24-well plate at a density of 30–50%, and GM, lentiviral infection enhancing reagent (Genechem) and 1.5 × 107 TU/mL Lentivirus were added sequentially. The total volume was 500 μL. After 72 hours of culture, the culture medium was replaced with GM and the transfection efficiency was observed under a fluorescence microscope (MZ75, Leica, Bensheim, Germany). Cells expressing green fluorescent protein were deemed to be successfully transfected. The cell transfection rate was calculated as the number of green fluorescent cells/total cells.
+ Open protocol
+ Expand
3

Lentiviral Manipulation of Nrf2 in SKPs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant lentiviruses used for overexpressing and silencing nrf2 were purchased from GeneChem (Shanghai, China). LentiORF lentiviral particles (GV358, Ubi-MCS-3FLAG-SV40-ERFP-IRES-puromycin, LVKL25280-2) and lenti-shRNA vectors (GV248, hU6-MCS-ubiquitin-EGFP-IRES-puromycin, LVpFU-GW-007) were constructed, packed, and purified by GeneChem (Shanghai, China). SKPs were transfected with lentivirus-containing lenti-RFP control (lenti-C or lenti-C-SKPs), lenti-overexpressed nrf2 (lenti-nrf2 or nrf2-over-SKPs), lenti-silenced nrf2 (lenti-shRNA-nrf2, lenti-shnrf2, or si-nrf2-SKPs), and lenti-shRNA-GFP-negative control (lenti-shNC or lenti-shNC-SKPs). Next, SKPs were incubated at 37°C/5% CO2 and selected using puromycin. Lastly, puromycin-resistant cells were allowed to grow in the SKP medium for further experiments.
+ Open protocol
+ Expand
4

Modulating EBV-miR-BART8-3p Expression in Nasopharyngeal Carcinoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral particles (GV369 and Ubi-MCS-SV40-EGFP-IRES-puromycin) containing EBV-miR-BART8-3p precursors and lentiviral particles (GV280 and hU6-MCS-Ubiquitin-EGFP-IRES-puromycin) containing reverse complement of EBV-miR-BART8-3p and their control vectors were constructed by Shanghai Genechem Co., Ltd. (Shanghai, China).CNE-1 and SUNE-1 cells were transfected with a recombinant lentiviral vector GV369 to upregulate EBV-miR-BART8-3p expression (CNE-1-BART8-3p and SUNE-1-BART8-3p cells), and C666–1 cells were transfected with a lentiviral vector GV280 to downregulate EBV-miR-BART8-3p expression (C666–1-BART8-3p cells). The transfection efficiency was checked using qPCR assay.
For the rescue assay, CNE-1-BART8-3p cells and SUNE-1-BART8-3p cells were transfected with the RNF38 lentiviral vector GV358 (Shanghai Genechem Co., Ltd.; Shanghai, China) or a normal control (Shanghai Genechem Co., Ltd.; Shanghai, China).
+ Open protocol
+ Expand
5

Genetic Manipulation of ESCC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA against human GDF15 (hU6-MCS-CBh-gcGFP-IRES-puromycin) and the appropriate scramble control siRNA were purchased from Genechem Co. Ltd. (Shanghai, China). ESCC cells at 30–50% confluence were transfected with lentivirus vector in the presence of 5 μg/mL of polybrene for 24 h. Lentivirus-mediated overexpression of SCAP (Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin) and the appropriate negative control was purchased from Genechem Co. Ltd. (Shanghai, China). ESCC cells at 30–50% confluence were infected with lentivirus in the presence of 5 μg/mL of polybrene for 24 h. MiR-1324 mimics (5′CCAGACAGAAUUCUAUGCACUUUC3′, 5′AAGUGCAUAGAAUUCUGUCUGGUU3′) and the negative control were obtained from (GeneCopoeia Inc. Maryland). ESCC cells at 50–80% confluence were transfected with the mimics in the presence Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions for 48 h. Lentivirus-mediated overexpression of miR-1324 (hU6-MCS-Ubiquitin-EGFP-IRES-puromycin) and negative control was obtained from Genechem Co. Ltd. (Shanghai, China). ESCC cells at 30–50% confluence were infected with lentivirus in the presence of 5 μg/mL of polybrene for 24 h.
+ Open protocol
+ Expand
6

Overexpressing S1P and SREBP1 in RCC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The full-length S1P cDNA and SREBP1 cDNA were provided by Genechem and individually annealed into a GV280 vector (hU6-MCS-Ubiquitin-EGFP-IRES-puromycin, Genechem). The construct was then transfected to HEK-293T cells along with lentivirus package plasmids (Genechem) to generate S1P-expressing lentivirus (LV-S1P) and SREBP1-expressing lentivirus (LV-SREBP1). Thereafter, viruses were enriched (to 2 × 108transducing units/mL), filtered and added to cultured RCC cells. Cells were cultured in a polybrene-containing complete medium. Stable cells were established via adding puromycin. S1P or SREBP1overexpression in stable cells was verified by RT-qPCR and Western blotting assays. Control cells were transduced with an empty vector (GV280).
+ Open protocol
+ Expand
7

NOTCH 1 Knockdown in hPSC-HASMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
NOTCH 1-targeted short hairpin RNAs (shRNA, hU6-MCS-Ubiquitin-EGFP-IRES-puromycin) were designed and composed by GeneChem (Shanghai, China). hPSC-HASMCs were seeded into 6-well plates (6 × 105 cells per well) and incubated in a cell incubator. Cells were divided into 3 groups, including the control group, shRNA control (scrambled) group and NOTCH 1 knockdown group (NOTCH 1-KD), when they reached 30% confluency. The shRNA control and NOTCH 1-KD groups were infected with LV-non-specific shRNA and LV-shRNA-NOTCH-1 at an MOI of 10 according to the product manual. After an infection time of 12 h, virus particles were removed from the respective wells, and then, the wells were replenished with fresh SMCM. Cells were further cultured for 72 h in cell culture incubation. Then, the cells were treated with 2.0 μg/mL puromycin, and GFP-positive cells were selected. After the GFP-positive cells reached approximately 80% confluency, they were harvested. The efficiency of NOTCH 1 knockdown was verified by RT-qPCR and western blotting analyses.
+ Open protocol
+ Expand
8

Overexpression of let-7a in SMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The let-7a overexpression lentiviral vector GV280: hU6-MCS-Ubiquitin-EGFP-IRES-puromycin (Shanghai GeneChem Co., Ltd., Shanghai, China) was transfected at a multiplicity of infection of 10 (1 × 107 TU/ml) for 12 h at 37 °C after cells were grown to a density of 30–40%. After 72 h, the transfection efficiency was observed using white-light microscopy and fluorescence microscopy. Subsequently, the cells were selected using 1 μg/ml puromycin (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) until there were no dead cells in the culture plates. Transfected cells were used for western blot, RT-qPCR, and cell function assays.
Verteporfin (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) was used at a dose of 1 μM for 24 h at 37 °C to treat SMCs to block the hippo-YAP1 axis. Verteporfin was dissolved in dimethyl sulfoxide (DMSO; Sigma, Missouri, USA). We used DMSO as the control treatment at a dose of 1 μM for 24 h at 37 °C to treat smooth muscle cells and then harvested the cells for subsequent experiments.
+ Open protocol
+ Expand
9

Lentivirus-Mediated miRNA-210 Agonist Therapy for Acute Myocardial Infarction

Check if the same lab product or an alternative is used in the 5 most similar protocols
The animals were randomly divided into 4 groups: i) Sham-operated (Sham; 12 rats) rats received all surgical procedures except for ligation of the LAD coronary artery; ii) AMI and treatment with negative control vector (AMI + NV; 7 rats); iii) AMI (AMI; 8 rats); and iv) AMI and treatment with lentivirus-mediated miRNA-210 agonist (AMI + LV-miR-210 agonist; 9 rats). The myocardial transfection in vivo was performed via intravenous injection with LV-miR-210 agonist (precursor-hsa-miR-210; Shanghai Genechem Co., Ltd., Shanghai, China) or negative control vector (hu6-MCS-Ubiquitin-EGFP-IRES-puromycin; Shanghai Genechem Co., Ltd.). The forward primer sequence for hsa-miR-210 was 5′-GGAAAGGACGAAACACCGGGGACAAGAGAGGAGTGGCTCTG-3′, and the reverse primer sequence was 5′-TGTCTCGAGGTCGAGAATTAAAAAACTAGTGGCCCACTACCCTGTC-3′, which were amplified into the 301-bp product as described previously (4 (link)). The negative control vector and LV-miRNA210 agonist were added to PBS to a final volume of 0.5 ml, which was applied to each rat, while untreated rats received PBS (0.5 ml) only.
+ Open protocol
+ Expand
10

Overexpression and Knockdown of UPF1 in Ishikawa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
UPF1 overexpression lentivirus (Ubi-MCS-3FLAG-SV40-EGFP-IRES-puromycin) named lv-UPF1+, and RNAi lentivirus(hU6-MCS-Ubiquitin-EGFP-IRES-puromycin) named lv-UPF1-RNAi were synthesized by GeneChem (Shanghai, China), which controls were lv-CON238 and lv-CON077 respectively. Lentivirus was transfected by the above constructs with packaging plasmids into Ishikawa cell lines. After 3 days of infection, those cells not effectively infected were killed by 5 μg/ml puromycin. The infected cells finally became a stable cell line under the maintenance of puromycin, and was verified by production of green fluorescent protein (GFP) under a fluorescence microscope.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!