Iscript first strand cdna synthesis kit

To determine expression of TLR9 and RIG-I at basal and stimulated conditions, End1/E6E7 cells were grown in KSFM in 24 well plates. Cells were stimulated with fresh media containing CpG-ODN or Poly(I:C)LL (10 µg/mL) for 6 hrs at 37°C before analyzing TLR9 and RIG-I expression by a battery of assays that include qPCR, RT-PCR, Western blot, flow cytometry and indirect immunofluorescence. The concentration of PRR ligands used in this study was based on in vitro studies published previously [3] (link), [17] (link).
To determine TLR9, RIG-I, IL-6 and IL-8 mRNA expression, End1/E6E7 cells were stimulated with CpG-ODN (10 µg/ml), Poly (I: C)LL (10 µg/ml) for 6 hrs. Total RNA was extracted using Trizol reagent according to the manufacturer's recommendations (Invitrogen). One µg of total RNA was reverse-transcribed using the iScript first strand cDNA synthesis kit (Bio-Rad, USA). Relative mRNA expression levels of genes of interest were measured using SYBR Green chemistry on the Bio-Rad CFX 96 well real time PCR machine (Bio-Rad). Sequences of primers used for analysis are given in Table 1. Unstimulated cells served as controls. Data was analyzed with untreated values set as calibrator and expression normalized to 18S rRNA. Fold change was calculated by 2^−ΔΔCt method.

RNA was isolated from the HF patients and unaffected controls using the Aurum™ total RNA mini kit (Bio-Rad, Hercules, California, USA). The RNA was qualitatively verified on denaturing formaldehyde 1.2% agarose gel electrophoresis. Using 1 μg of RNA, respective cDNAs was synthesized using iScript™first strand cDNA synthesis kit (Bio-Rad, Hercules, California, USA). qPCR was carried out to compare GRK5 gene expression in HF cases and healthy controls using relative quantification with β-actin as reference gene. PCR mixture of 20μL contained 2X SYBR green (Sso Advanced universal SYBR^® Green supermix, Bio-Rad, Hercules, California, USA), 50 nM of forward and the reverse primer of the respective gene, cDNA template corresponding to 1 μg RNA and nuclease free water. The primers used were GRK5 FP (5’ - ACCTGAGGGGAGAACCATTC - 3’), GRK5 RP (5’ -TGGACTCCCCTTTCCTCTTT - 3’), ACTIN FP (5’ - TCCCTGGAGAAGAGCTACG - 3’), and ACTIN RP (5’ - GTAGTTTCGTGGATGCCACA - 3’). Reaction included an initial denaturation of 95°C for 3 min followed by 45 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 45 s, and a melt curve analysis (65 – 95°C) was performed at the end of 45 cycles. Normalized fold expression was calculated using 2^–ΔΔCt method.

Total RNA from tissues or cells was extracted using TRIZOL (Invitrogen). cDNA synthesis was performed with 1–2 µg of RNA using iScript First Strand cDNA synthesis kit (BioRad #170-8891). Quantitative real time-PCR (qRT-PCR) was carried out using GoTaq Q-PCR Master Mix (Promega) in a 7500 Fast Real-Time PCR System (Applied Biosystems). Reactions were performed in triplicate and normalized by β-actin or Gapdh expression in the case of the muscle. Primer sequences are described in Supplementary Information (Table S4).

Total RNA was extracted using TRIzol reagent (Sigma) according to the manufacturer’s instructions. RNA concentration and quality were determined via A260/230 and A260/A280 nm absorbance with Nanodrop Spectrophotometer. 500 ng of total RNA was subjected to reverse transcriptase (RT) reaction using iScript First Strand cDNA Synthesis kit (BIO-RAD) with random hexamer primers according to the manufacturer’s instructions (as previously described^{50 (link)}).

RNA was extracted from 2D and dissociated 3D cultures using an RNeasy Plus kit (Qiagen), and 1 μg of total RNA was reverse transcribed with the iScript™ first-strand cDNA synthesis kit (BioRad). Following cDNA synthesis, quantitative PCR was set up using SsoFast™ EvaGreen^® supermix (Biorad) with optimized cycling conditions for LightCycler 480II (Roche). Based on preliminary analysis of microarray data, the following genes were selected as being differentially up- or downregulated between 2D and 3D conditions: Jun proto-oncogene (JUN), sirtuin 2 (SIRT2), Ras-related GTP binding protein (RAB6A), and CDC-like kinase 1 (CLK1), MYC, ADAM metallopeptidase with thrombospondin type 1 motif 6 (ADAMTS6), and BMI polycomb ring finger oncogene (BMI1). Housekeeping genes used were glucuronidase beta (GUSB), heat shock protein 90 kDa alpha class B member 1 (HSP90AB1), and hypoxanthine phosphoribosyltransferase 1 (HPRT1).