Genematrix universal rna mirna purification kit

RNA was isolated using Gene MATRIX Universal RNA/miRNA Purification Kit (EURx) and transcribed to cDNA with Transcriptor Universal cDNA Master (Roche). Primer sequences are given in Table S2. Transcript abundance was measured using iTaq Universal SYBR Green Supermix (Bio-Rad) and LightCycler 480. 18S RNA was used as a housekeeping control gene. Relative transcript abundance was assessed using the 2^-ΔΔCT method as previously described [30 (link)].

RNA and microRNA were isolated using Gene MATRIX Universal RNA/miRNA Purification Kit (EURx, Gdansk, Poland) and transcribed to cDNA with Transcriptor Universal cDNA Master (Roche) and TaqMan MicroRNA Reverse Transcription (Applied Biosystems), respectively. Primer sequences are given in Table S3. Transcript abundance was measured using Itaq Universal SYBR Green Supermix (Bio-Rad) and LightCycler 480. GAPDH and U6 snRNA were used as housekeeping control genes for mRNA and miR-494, respectively. Relative transcript abundance was assessed using the 2^−ΔΔCT method as previously described [46 (link)].

Isolation of mRNA from HBFs was performed using the GeneMATRIX Universal RNA/miRNA Purification Kit (EURx, Gdańsk, Poland) according to the manufacturer’s protocol. The concentration of isolated mRNA was measured in a NanoDrop spectrophotometer (Implen) at OD260/280 nm. Two thousand nanograms of extracted mRNA, the NG dART RT-PCR Kit (EURx) and C1000 Touch Thermal Cycler (Bio-Rad) were used for cDNA synthesis. Gene expression was measured with SYBR Green PCR Master Mix (Applied Biosystems) and specific primer sets (described in Table 2; all from Genomed, Warszawa, Poland) using the 7500 Fast System (Applied Biosystems). Relative amounts of genes were estimated using the quantification threshold value recalculated against GAPDH transcripts by the ^∆CT method [^∆CT refers to CT_{(tested gene)}-CT_(GAPDH)] and are presented as a 2^{-ΔCt mean} value.Table 2

Primers used for quantitative PCR.

Gene name	Sequence 5′–3'
	Forward	Reverse
ACTA2 (α-SMA)	CTGTTCCAGCCATCCTTCAT	CCGTGATCTCCTTCTGCATT
Smad1	ACCTGCTTACCTGCCTCCTG	CATAAGCAACCGCCTGAACA
Smad2	CGTCCATCTTGCCATTCACG	CTCAAGCTCATCTAATCGTCCTG
Smad3	GCGTGCGGCTCTACTACATC	GCACATTCGGGTCAACTGGTA
Smad5	CTGGGATTACAGGACTTGACC	AAGTTCCAATTAAAAAGGGAGGA
TGF-β1	AGGGCTACCATGCCAACTTCT	CCGGGTTATGCTGGTTGTACA
GAPDH	GAAGGTGAAGGTCGGAGT	GAAGATGGTGATGGGATTTC

RNA was isolated using a GeneMATRIX Universal RNA/miRNA Purification Kit (EURx), according to the manufacturer’s instruction. RT-PCR with random primers (Promega, Madison, WI, USA) and Moloney murine leukemia virus MMLV reverse transcriptase (Promega) was performed according to the vendor’s protocol.

RNA isolation from herbivore-infested and uninfested leaves was performed using GeneMATRIX Universal RNA/miRNA Purification Kit (EURx, Gdańsk, Poland). Reverse transcription was performed using QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany).

RNA was extracted using Gene MATRIX Universal RNA/miRNA Purification Kit (EURx), according to manufacturer instructions. High-quality samples (RIN≥8, determined with Bioanalyzer instrument) were enriched in poly(A)-containing mRNA using Dynabeads mRNA DIRECT Micro Kit (Thermo). The libraries were prepared with Ion Total RNA-Seq Kit v2 (Thermo) and sequenced on Ion Porton sequencer as described before (22 (link)). The raw reads were processed with Ion Torrent RNASEQ Analysis pipeline (Torrent Suite version 5.0.4) which maps reads to hg19 genome with STAR2 and bowtie2 aligners. Gene counts were generated with htseq-count version 0.6. Gene expression analysis was performed in R environment (v 4.0.4) using DESeq2, ClusterProfiler, fgsea and enrichplot packages (23 (link), 24 (link)). Sequencing results are available via Gen Expression omnibus under accession number GSE208543.

RNA from the cell lines was extracted using a GeneMATRIX Universal RNA/miRNA Purification Kit (EURx) according to the vendor’s instruction. cDNA was obtained from RNA by performing RT-PCR with random primers (Promega, Madison, WI, USA) and Moloney murine leukemia virus MMLV reverse transcriptase (Promega) according to the manufacturer’s protocol.