Ptc 200 thermal cycler

Detection of the V. parahaemolyticus tdh and trh genes was performed by PCR as described previously (Gutierrez West et al., 2013 (link)). The oligonucleotide primers were synthesized by Sangon Biotech (Shanghai, China) (Tdh-F: CTGTCCCTTTTCCTGCCCCCG, Tdh-R: AGC CAGACACCGCTGCCATTG; Trh-F: ACCTTTTCCTTCTCCWGGKTCSG, Trh-F: CCGCTC TCATATGCYTCGACAKT). Each reaction mixture included the following (total volume, 25 μL): 2 × PCR Mix (Qiagen), 12.5 μL; 0.5 μM each primer, dd H₂O, 9.5 μL; and DNA template, 1 μL. Both genes were amplified using the following thermal-cycling program: denaturation at 95°C for 5 min; 40 cycles of 95°C for 1 min, 62°C for 1 min, and 72°C for 1 min; and a final extension of 72°C for 2 min. PCR was conducted in a Bio-Rad PTC-200 Thermal Cycler (Bio-Rad, Hercules, CA, USA). The amplified products were then analyzed electrophoretically on a 2% agarose gel containing Gold View. The images were captured digitally and analyzed using a Gel Image system (Bio-Rad). V. parahaemolyticus strains ATCC 33847 (tdh+) and ATCC 17802 (trh+) were used as positive controls, and distilled water was used as the negative control.

For ERIC-PCR, the primers ERIC1 (5′-ATGTAAGCTCCTGGGGATTCAC-3′) and ERIC2 (5′-AAGTAAGTGACTGGGGTGAGCG-3′) were used (Versalovic et al., 1991 (link)). PCR was performed in a 25 μL solution containing 1.0 U of Taq DNA polymerase (Dongsheng Biotech, Guangdong, China), 1.0 μM of each primer, 2.5 mM MgCl₂, 0.2 mM of each dNTP, and 40 ng of template genomic DNA. Amplifications were performed with a Bio-Rad PTC-200 Thermal Cycler (Bio-Rad) under the following conditions: an initial denaturation at 94°C for 5 min; 35 cycles of 1 min at 94°C, 1 min at 49°C, and 3 min at 72°C; and a final extension at 72°C for 10 min. ERIC-PCR products were detected by a 2.0% agarose gel electrophoresis with Gold View (0.005% v/v) in 1 × TAE buffer (40 mM Tris–HCl, 1.18 mL acetic acid, 2 mM EDTA, pH 8.0), and the gel was photographed using a UV Imaging System (GE Healthcare). The images were captured in TIFF file format for further analysis with BioNumerics software version 6.0 (Applied Maths, Kortrijk, Belgium).

The serotypes of V. parahaemolyticus isolates were identified using the PCR-based O-antigen serotyping technique. The primer concentrations and amplification conditions used were as described previously (Chen M. et al., 2012 (link)). The primers used for this assay were synthesized by Sangon Biotech (Shanghai, China). The 12 primer pairs were divided into two groups to amplify target DNA; PCR group 1 was used to detect serogroups O1, O2, O4, O5, O6, and O10, whereas PCR group 2 was used to detect serogroups O3/O13, O7, O8, O9, O11, and O12. The PCR was performed in a 25-μL reaction mixture containing the following: 2 × PCR mix (Dongshen, Guangzhou, China), 12.5 μL; 0.5 μM each primer, dd H₂O, 9.5 μL; and DNA template, 1 μL. All amplifications were carried out with the following protocol: 30 cycles of 95°C for 30 s, 60°C for 45 s, and 72°C for 1 min. The thermal cycler was prewarmed to 80°C before all the reaction tubes were added in order to reduce nonspecific amplification. PCR was conducted in a Bio-Rad PTC-200 Thermal Cycler (Bio-Rad, California, USA). The amplified products were then analyzed electrophoretically on a 2% agarose gel containing Gold View. The images were captured digitally and analyzed using the Gel Image system (Bio-Rad, California, USA). V. parahaemolyticus ATCC 17802 and ATCC 33847 were used as control strains.

Carbapenem-resistant isolates were genotypically examined for blaKPC-1, blaIMP-1, blaVIM-1, blaNDM-1, and blaOXA-48 genes by PCR methods using gene-specific primers (Table 1) described by Poirel and colleagues [41 (link)]. The PCR assay was carried out with a 20 μL reaction mixture containing 2 μL genomic-DNA, 1x Standard reaction buffer, 0.3mM each of dATP, dCTP, dTTP, and dGTP, 200 nM each of Forward and Reverse primers, and 1.25 U OneTaq DNA Polymerase (New England Biolabs Inc., USA). PCR reactions were performed using the Bio-Rad PTC-200 Thermal Cycler (Bio-Rad Laboratories, USA) with the following cycling conditions; an initial denaturation at 94°C for 3 mins, followed by 40 cycles at 94°C for 30sec, 56°C for 30sec, and 68°C for 30sec. Finally, an elongation step was performed at 68°C for 5 minutes. Afterward, the PCR products were resolved by agarose gel electrophoresis and visualized under UV light using UVP Bio-Doc- It Imaging system–trans-illuminator (AnalytikJena, Germany).

Triplex PCR was performed to detect the toxR gene specific to the Vibrio species, the serogroup O3-specific gene vp0209 and the serovar K6-specific gene vp0230 according to Zhang’s protocol [22 (link)-24 ]. The forward (F) and reverse (R) primers of the three detected genes are listed in Table 1. These oligonucleotide primers were synthesized by Sangon Biotech (China). The amplification conditions used for the triplex PCR were set up according to the protocol of Zhang et al. with slight modifications [24 ]. In brief, the 25 μl reaction mixture was composed of 12.5 μl of 2× Taq Master Mix (Shanghai Generay Biotech Co., Ltd.), each primer at 0.5 μM, 6.5 μL of ddH₂O, and 2 μl of DNA template. The thermal cycling parameters for PCR were as follows: denaturation at 95°C for 2 min, 30 cycles of 95°C for 30 sec, an annealing temperature of 56°C for 30 sec, and 72°C for 1 min, with a final extension of 72°C for 5 min. PCR was performed on a Bio-Rad PTC-200 Thermal Cycler (Bio-Rad, USA). The amplified products were analyzed electrophoretically on a 1.2% agarose gel containing Gel Stain (Sangon Biotech, China) and photographed using an Amersham Imager 600 UV (GE Healthcare, USA).

Total RNA was isolated from cells using the RNeasy Mini kit (Qiagen, Hilden, Germany) and the quantity of total RNA was measured using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNA synthesis was performed using oligo (dT) 15 primer and GoScript Transcriptase according to manufacturer’s instructions (Promega GmbH, Mannheim, Germany). The PCR mixture contained: 1.5 uL of cDNA, 1× PCR buffer (Sigma Aldrich) 2.5 mM Magnesium Chloride (Sigma Aldrich), 0.2 mM dNTPs (Sigma Aldrich), 0.2 uM of each primer (Sigma Aldrich), and 1.25 U JumpStart™ Taq DNA Polymerase (Sigma Aldrich). The cDNA was amplified by PCR using the MJ Research PTC-200 Thermal Cycler with the following primers: CAIX (Carbonic Anhydrase 9) forward (5′-TACAGCTGAACTTCCGAGCG-3′), CAIX reverse (5′-CTAGGCTCCAGTCTCGGCTA-3′), HPRT1 (Hypoxanthine-Guanine Phosphoribosyltransferase) forward (5′-TGGCGTCGTGATTAGTGATG-3′), HPRT1 reverse (5′-TATCCAACACTTCGTGGGGT-3′). The PCR conditions for all analyzed genes were as following: denaturing at 95 °C for 5 min, followed by 30 cycles of 30 s at 95 °C, 30 s at 58 °C and 30 s at 72 °C. The reaction was completed for 10 min at 72 °C. The PCR reaction was evaluated by checking the PCR products on 1.5% w/v agarose gels. Bands were normalized by use of HPRT1 to correct for differences in loading of the cDNAs.