Gel documentation system

Manufactured by Analytik Jena

Sourced in United Kingdom, Germany, United States

The Gel documentation system is a scientific instrument designed for the visualization, capture, and analysis of DNA, RNA, and protein samples separated by electrophoresis and stained with fluorescent dyes. It provides a reliable and efficient way to document and analyze gel-based experiments.

Automatically generated - may contain errors

Lab products found in correlation

54 protocols using gel documentation system

Klebsiella Identification by PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA extraction from the suspected Klebsiella spp. colonies was performed using the QIAamp DNA Mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. PCR amplifications were carried out in a 25-µL reaction volume using the Applied Biosystems 2720 Thermal Cycler (Foster City, CA, USA). The reaction mixture included 12.5 µL of Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µL of each primer (Metabion, Steinkirchen, Germany) at a concentration of 20 pmoL, 4.5 µL of nuclease-free water, and 6 µL of extracted DNA template. Genus- and species-specific primers for K. pneumoniae were used in the PCR amplification (Table 1).
The PCR products were separated by electrophoresis on a 1.5% agarose gel (Applichem, Darmstadt, Germany) prepared in 1X TBE buffer using a voltage gradient of 5 V/cm [21 ]. For gel analysis, 20 µL of PCR products was loaded into each gel slot, and a 100-bp DNA ladder (Fermentas, Thermo Scientific, Bremen, Germany) was used as a size marker. The gel was photographed using a gel documentation system (Alpha Innotech, Biometra, Göttingen, Germany), and the resulting data were analyzed.

Mahrous S.H., El-Balkemy F.A., Abo-Zeid N.Z., El-Mekkawy M.F., El Damaty H.M, & Elsohaby I. (2023). Antibacterial and Anti-Biofilm Activities of Cinnamon Oil against Multidrug-Resistant Klebsiella pneumoniae Isolated from Pneumonic Sheep and Goats. Pathogens, 12(9), 1138.

+ Open protocol

+ Expand

Conventional PCR for Virulence Gene Detection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

A conventional polymerase chain reaction (PCR) assay was performed for detection of virulence genes. DNA was extracted from isolates using a QIAamp DNA Mini Kit following kit instructions, (Qiagen, Germany, GmbH) catalog no. 51304. PCR used extracted DNA using specific primers (Metabion, Germany) [30 (link),31 (link)] to amplify virulence genes (sopB and spvC) (Table-1) using PCR Master Mix (Takara, Japan). The amplification was performed in a Biometra T3 thermal cycler. The PCR products were separated by electrophoresis on 1% agarose gel according to Sambrook et al. [32 ] (Applichem, Germany) in 1× TBE buffer at room temperature (24°C) using a gradient of 5 V/cm. Fifteen μL of PCR product was loaded in each gel slot. A 100 bp DNA Ladder (Qiagen, Germany) was used to determine fragment sizes. The gel was photographed with a gel documentation system (Alpha Innotech, Biometra, Germany).

Badr H., Soliman M.A, & Nasef S.A. (2020). Bacteriological and molecular study of Salmonella species associated with central nervous system manifestation in chicken flocks. Veterinary World, 13(10), 2183-2190.

+ Open protocol

+ Expand

Agarose Gel Electrophoresis of PCR Products

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR products were separated by electrophoresis on 1% agarose gel (Applichem, Germany, GmbH) in 1× TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 15 µl of products were loaded in each gel slot. Gel pilot 100 bp plus ladder (Qiagen, Germany, GmbH) was used to determine the fragment size. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra).

Eid S., Marouf S., Hefny H.Y, & Al-Atfeehy N.M. (2019). Pasteurellaceae members with similar morphological patterns associated with respiratory manifestations in ducks. Veterinary World, 12(12), 2061-2069.

+ Open protocol

+ Expand

Agarose Gel Electrophoresis of DNA Fragments

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 1% solidified agarose gel (Sinagen, Iran) containing 2 µL of ethidium bromide (5 µg mL^-1) was placed in the electrophoresis tank, and 0.5 L of 1× TAE of buffer (pH 8.0) was poured in the tank. Aliquots (10 to 12 µL) of the amplified products were mixed with 2 µL of gel-loading dye and were subjected to electrophoresis wells. A DNA size-marker (1kb, Gene Ruler DNA Ladder Plus; MBI Fermentas) was used as a molecular mass marker to ensure that the correct regions were amplified. The amplified products were electrophoresed at a constant voltage of 70 V for 1h. The amplification products were visualized in a gel documentation system (Biometra, Gottingen, Germany). The DNA fragments with a size of 1500 bp indicated the correct amplification.

Nami Y., Haghshenas B, & Yari Khosroushahi A. (2018). Molecular Identification and Probiotic Potential Characterization of Lactic Acid Bacteria Isolated from Human Vaginal Microbiota. Advanced Pharmaceutical Bulletin, 8(4), 683-695.

+ Open protocol

+ Expand

SDS-PAGE Analysis of Bee Hemolymph Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The proteins from samples of bee’s hemolymph were expressed using SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) (Atto corporation, AE-6530 M, Japan) according to the standard protocol (Severson et al., 1990 (link)). Ten microliters of the hemolymph samples were loaded on 8% acrylamide gel, and electrophoresis was performed with 20 mA current for 5 h. The standard protein ladders (BenchMark: Novex, life technologies and Pink plus: GeneDireX, Inc.) were also loaded on gels to assess the molecular size (kDa) of the expressed proteins (Wilson and Walker, 2010 ). The gel was stained with standard Coomassie blue stain (0.1% Coomassie R250, 10% acetic acid and 40% methanol) overnight, rinsed with distilled water and de-stained with de-staining solution (20% methanol, 10% acetic acid and ddH₂O) until there was clear visibility of bands on the gel. The pictures of the gel were taken using a gel documentation system (Biometra GmbH, Germany).

Alqarni A.S., Ali H., Iqbal J., Owayss A.A, & Smith B.H. (2019). Expression of heat shock proteins in adult honey bee (Apis mellifera L.) workers under hot-arid subtropical ecosystems. Saudi Journal of Biological Sciences, 26(7), 1372-1376.

+ Open protocol

+ Expand

Agarose Gel Electrophoresis of PCR Products

Check if the same lab product or an alternative is used in the 5 most similar protocols

The products of PCR were separated by electrophoresis on 1% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5 V/cm. For gel analysis, 20 µL of the PCR products were loaded in each gel slot. Gene ruler 100 bp DNA ladder (Fermentas, Sigma) was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data were analyzed through computer software.

Torky H.A., Saad H.M., Khaliel S.A., Kassih A.T., Sabatier J.M., Batiha G.E., Hetta H.F., Elghazaly E.M, & De Waard M. (2023). Isolation and Molecular Characterization of Corynebacterium pseudotuberculosis: Association with Proinflammatory Cytokines in Caseous Lymphadenitis Pyogranulomas. Animals : an Open Access Journal from MDPI, 13(2), 296.

+ Open protocol

+ Expand

Identification and Characterization of Antagonistic Bacteria

Check if the same lab product or an alternative is used in the 5 most similar protocols

The antagonistic bacteria were identified by 16S rRNA gene analysis. Genomic DNA was extracted by CTAB method (Moore et al., 1999 ). The extracted DNA was qualitatively analyzed on agarose gel (1% W/V) pre-stained with ethidium bromide and electrophoresed in 1× TBE buffer at 100 V for 30–40 min.
DNA bands were visualized in the Gel documentation system (Biometra, Germany) and their quality was compared with that of the DNA ladder (Thermo Scientific). The 16S rRNA gene was amplified by using the primers P1 and P6 (Tan et al., 1997 (link)). A 50 μL PCR reaction consisted of PCR water (31 μL), 5 μL Taq buffer (10x), 4 μL MgCl₂ (25 mM), 3 μL dNTPs (10 mM), 2 μL of each primer (100 pM), 0.5 μL Taq polymerase (500 U), and 2.5 μL template DNA (25 ng/μL). The reaction was amplified in a thermal cycler (Applied Biosystems, United States) using the cycling conditions, namely, initial denaturation (95°C for 5 min), 25 cycles x (denaturation at 95°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 1.5 min) and final extension at 72°C for 5 min. The PCR products were visualized by gel electrophoresis (as described above) and purified by using PCR purification kit (Thermo Scientific).

Mulk S., Wahab A., Yasmin H., Mumtaz S., El-Serehy H.A., Khan N, & Hassan M.N. (2022). Prevalence of Wheat Associated Bacillus spp. and Their Bio-Control Efficacy Against Fusarium Root Rot. Frontiers in Microbiology, 12, 798619.

+ Open protocol

+ Expand

Gel Electrophoresis Analysis of PCR Products

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR products were separated by electrophoresis at room temperature (25°C) on 1.5% agarose gel (AppliChem, Germany, GmbH) in 1× Tris-borate-EDTA buffer with gradients of 5 V/cm. A Gel documentation system (Alpha Innotech, Biometra, Germany) was used to photograph the gel (Gel documentation system; Biometra, Germany) and the data were evaluated using a computer software (Genesys image capture, Biometra, Germany).

Ibrahim E.S., Arafa A.A., Dorgam S.M., Eid R.H., Atta N.S., El-Dabae W.H, & Gaber Sadek E. (2022). Molecular characterization of genes responsible for biofilm formation in Staphylococcus aureus isolated from mastitic cows. Veterinary World, 15(1), 205-212.

+ Open protocol

+ Expand

Amplifying ITS-1 Region by PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The primers F (5′-GCAAAAGTCGTAACACGGTTTCC-3′) and R (5′-CTGCAATTCACAATGCGTATCG-3′) were used for amplification of the ITS-1 region of the extracted DNA by conventional PCR (Khodakaram-Tafti et al., 2013) . The reactions took place in a thermal cycler (Biometra T3 Thermocycler, Göttingen, Germany) with an initial denaturation for 5 min at 94°C. An amplification step was performed for 35 cycles of denaturation at 94°C for 30 seconds, and annealing at 56°C for 1 min, then an extension for 1 min at 72°C, with a further extension step at 72°C for 10 min (Verma et al., 2017) . The PCR products from ITS-1 rDNA were separated on 1.5% agarose gel in 1x TBE buffer at 37°C with 5V/cm of gradients. Fragment size was detected using DNA Ladder of 100pb (Qiagen, Germany). After that, a gel documentation system (Alpha Innotech, Biometra) was used to photograph this gel.

Hassanen E.A. (2020). Prevalence and Phylogenetic Analysis of Eimeria Species in Sheep and Goats in Sharkia Governorate, Egypt. Pakistan Veterinary Journal, 40(04), 437-442.

+ Open protocol

+ Expand

PCR Detection of E. coli in Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polymerase chain reaction for detection of E. coli was performed according to 16 (link) . Specific primers were used in this study ECO223F (5'ATCAACCGAGATTCCCCCAGT 3') and ECO223R (5'TCACTATCGGTCAGTCAGGAG3') (produced by IDT-USA). Amplification of DNA was performed in a total volume of 25µl containing: 12.5µl HS Prime Taq Premix (2X) (GeNetBio, Korea), 2µl of each forward and reverse primers, 6.5µl of PCR grade water and finally 2µl of DNA template. Positive and negative controls were also included in separate tubes. The mixture was subjected to amplification using thermocycler (QLS, UK) consisting of 1 cycle of initial denaturation at 95°C for 10 min, then 30 cycles of denaturation at 95°C for 30 sec, annealing at 58°C for 30sec and extension at 72°C for 1 min. The final extension was done at 72°C for 1min followed by cooling at 4°C forever. After amplification, the DNA products were analyzed by 1.5% agarose gel electrophoresis (Major Science, Taiwan) using 7 µl DNA ladder as a molecular weight marker (Gena Bioscience, Germany). The gel was visualized by UV transilluminator then photographed by Gel documentation system (Biometra, Germany).

Al-Chalaby A.Y. (2020). Detection of Escherichia coli from Imported and Local Beef Meat in Mosul City. Journal of Pure and Applied Microbiology, 14(1), 383-388.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!