Plenti cmv to puro empty

A 21mer sequence (5-GGTGTCACTATGGAGCTCTCA-3) was designed to generate the lentiviral vector of AR short hairpin RNA (shRNA) [21 (link)], and the vector construct, lentiviral production and infection were done according to previous description [19 (link)]. The lentiviral plenti-CMV-miR-124 vector was constructed to stably overexpressing mature sequence of miR-124. The vector of pLenti CMV/TO Puro empty (Addgene plasmid #17482 [22 (link)]) was purchased from Addgene. The genomic segment of miR-124 -2 sequences was amplified using primers miR-124-2-F: CCTGGATCCGCTGTAAATGGCATGGAGATAT and miR-124-2-R: GCGTCTAGAGCGGCTGTAATGGAAAAGTAG; and subcloned into BamH1 and Xbal sites of the pLenti CMV/TO Puro empty vector [23 (link)]. Lentivirus production and transduction were done according to a previous method [23 (link)].

pENTR4-V5 (Addgene, Watertown, MA, USA, #17425), pLenti CMV/TO Puro Empty (Addgene #17482), and pLenti CMV/TO Puro DEST (Addgene #17293) were gifts from Eric Campeau & Paul Kaufman. pBabe-KRas-GV (Addgene #9052) was a gift from William Hahn. pCMV-VSV-G (Addgene #8454) and pCMV-dR8.2 dvpr (Addgene #8455) were gifts from Bob Weinberg. Wild-type (WT) and K-Ras-GD mutants were generated from pBabe-K-Ras by site-direct mutagenesis. Ras constructs were subcloned into pENTR4-V5 and recombined into pLenti CMV/TO Puro DEST by clonase reaction.