Black maxisorp plates

The receptor blocking assay was adapted from Ratanabanangkoon et al. (35) . Black Maxisorp plates (Nunc) were coated overnight with 100 µL of 5 µg/mL human α7-acetycholine receptor chimera (adapted from (36)) in PBS. Plates were washed thrice with PBS and blocked with 1% BSA in PBS. 4 nM of biotinylated α-cobratoxin with various concentrations of 368_01_C01, 2552_02_B02, or a negative control IgG specific to dendrotoxins in 0.1% BSA was prepared and preincubated for 30 minutes at room temperature. Plates were washed thrice, and 100 µL of the preincubated toxin and antibody mixture was added to the blocked wells. Following incubation for one hour, the plates were washed thrice with PBS-T (PBS, 0.1% Tween-20) and thrice with PBS, and 100 µL of 1 µg/mL of Europium-labeled Streptavidin (Perkin Elmer, 1244-360) in 0.1% BSA was added. Following 30 minutes of incubation, plates were washed thrice with PBS-T and thrice with PBS and 100 µL of DELFIA Enhancement Solution (Perkin Elmer, 4001-0010) was added to each well. Signals were measured using a VICTOR Nivo Multimode Microplate Reader using excitation at 320 nm and emission at 615 nm. Each antibody concentration was tested in quadruplicate.

Subcloning of the α-cobratoxin binding selection output into pSANG10-3F and primary screening of candidates was performed as described elsewhere (19) . In brief, scFv genes from the selection outputs were subcloned from the pIONTAS1 phagemid vector to the pSANG10-3F expression vector using NcoI and NotI restriction endonuclease sites and transformed into E. coli strain BL21 (DE3) (New England Biolabs). From each of the two subcloned selection outputs, 184 colonies were picked and expressed in 96 well plates. The scFvs were assessed for their binding to biotinylated α-cobratoxin (5 µg/mL) indirectly immobilized on black Maxisorp plates (Nunc) with streptavidin (10 µg/mL) using a DELFIA-based assay. In total, 60 clones binding to α-cobratoxin were cherry-picked and sequenced (Eurofin Genomics sequencing service) using S10b primer (GGCTTTGTTAGCAGCCGGATCTCA). The antibody framework and CDR regions were annotated, and light chain CDR3 regions were used to identify 14 unique clones.

VH and VL genes of 13 unique α-cobratoxin-binding scFvs were converted to the IgG1 format as previously described (19) . The binding of the IgGs was confirmed and ranked using and expression-normalized capture (ENC) assay. Briefly, black Maxisorp plates (Nunc) were coated overnight with an anti-human IgG (Jackson ImmunoResearch, 109-005-098). Plates were washed thrice with PBS and blocked with PBS supplemented with 3% milk protein. Plates were washed thrice with PBS and 0.25x unpurified IgG-containing culture supernatant in PBS supplemented with 3% milk protein was added before incubating for one hour at room temperature. Plates were washed thrice with PBS-T and thrice with PBS before adding either 1 nM or 100 pM biotinylated α-cobratoxin in PBS supplemented with 3% milk protein to each well. After one hour of incubation, the plates were washed thrice with PBS-T and thrice with PBS. Then, 1 µg/mL of Europium-labeled Streptavidin (Perkin Elmer, 1244-360) in DELFIA Assay Buffer (Perkin Elmer, 4002-0010) was added. Following 30 minutes of incubation, plates were washed thrice with PBS-T and thrice with PBS, and DELFIA Enhancement Solution (Perkin Elmer, 4001-0010) was added for detection of binding. Based on these results, the two top clone, 2552_02_B02, was expressed and purified as described previously (19) .