Pspcas9 bb 2a gfp px458 48138

To generate a puromycin‐sensitive version of the CT33‐hTERT‐RPE1‐Cas9i cell line (received as a gift from Ian Cheeseman), the puromycin acetyltransferase (PAC) gene was targeted with CRISPR‐Cas9. Cells were transiently transfected with pSpCas9(BB)‐2A‐GFP (PX458; 48138; Addgene) vector encoding a sgRNA‐targeting PAC (5′‐TGTCGAGCCCGACGCGCGTG‐3′) using Lipofectamine 2000 (Invitrogen). GFP‐positive cells were isolated by FACS 2 days after transfection. Single clones were isolated by screening for susceptibility to 3 μg/ml puromycin, and indel formation was confirmed by Sanger sequencing of a PCR product isolated from genomic DNA. The selected clone, hereafter referred to as RPE1‐Cas9i, contained an 18 bp deletion in the PAC gene.

gRNA sequences were cloned in px458 (Addgene pSpCas9(BB)-2A-GFP (PX458) #48138) or px459 (Addgene pSpCas9(BB)-2A-Puro (PX459) #48139) vectors as reported previously^{70 (link)}. gRNAs were designed to delete whole exons by placing two double-strand breaks (see Supplementary Figs. 4d and 8c). Panc1, Mia-Paca2 and AR42J cells were transfected with two plasmids (one gRNA in px458 and the second in px459) simultaneously using JetPrime according to the manufacturer’s instructions. Cells were sorted 24 h after transfection and subsequently treated with puromycin for 36 h. After recovery, single-cell clones were isolated via limited dilution. Successful deletion was identified via a screening end-point PCR as well as RT-qPCR. Oligonucleotides and primers are listed in Supplementary Table 2.