Atg12 sirna

The GFP-tagged LC3 cDNA expression construct was a gift from Dr. Noboru Mizushima (Tokyo Medical and Dental University, Tokyo, Japan). The miRNA mimics, miRNA inhibitors, ATG5 siRNA, ATG12 siRNA, pDsRed1 Atg12 were synthesized by GenePharma (Shanghai, China). Cells were transfected using Lipofectamine 2000 (Invitrogen, USA), according to the manufacturer's protocol.

The HC11 murine mammary gland epithelial cell line and 293T cell line were purchased from National Collection of Authenticated Cell Cultures (Shanghai, China). HC11 was grown at 5% CO₂ in 1640 (Gibco, Cheshire, CT, USA), with 10% fetal bovine serum (FBS, Gibco, Cheshire, CT, USA), 1% sodium pyruvate (Gibco, Cheshire, CT, USA), and 1% glutamine (Gibco, Cheshire, CT, USA) at 37 °C. The 293T cell line was grown at 5% CO₂ in DMEM (Gibco, Cheshire, CT, USA), with 10% FBS (Gibco, Cheshire, CT, USA), 1% sodium pyruvate (Gibco, Cheshire, CT, USA), and 1% glutamine (Gibco, Cheshire, CT, USA) at 37 °C. HC11 cells were transfected with miR-30a-3p inhibitor (5′-3′: CUUUCAGUCGGAUGUUUGCAGC, Genepharma, Shanghai, China), Atg12 siRNA, Atg5 siRNA, negative control (Genepharma, Shanghai, China), pEGFP-C1, pEGFP-miR-30a-3p, pCMV6-Atg12, and control plasmids using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s protocol. Baf A1 (50 nM; CAS 88899-55-2, InvivoGEN, San Diego, CA, USA) and rapamycin (100 nM, V900930, Sigma-Aldrich, St. Louis, MO, USA) were applied.