ATTA on the P1 region of plasmid pGL4.11‐SHMT1(Human)‐Promoter‐fLuc was mutated into CGTA directly with a site‐directed mutagenesis kit (11003ES10, Yeasen). The HOXD8 plasmid was linearized by using restriction endonuclease NheI and XhoI. Two segments besides HOXD8 DNA binding segments in HOXD8 were amplified separately by PCR and purified by Gel Extraction Kit (Omega Bio‐Tek) after electrophoresis in agarose gel. These two DNA fragments were cloned to linearized vector through the KpnI and SmaI clone sites with the Hieff Clone One Step Cloning Kit (10911ES08, Yeasen). HOXD8 mutant plasmid, which knocked out the DNA binding region (197–256 amino acids), was constructed. Luciferase assays were performed in 293T cells with the pGL4.11‐SHMT1 promoter‐mutated luciferase reporter and HOXD8 mutant plasmid described above. Primers were as follows: SHMT1‐ΔP1‐F: TGCTCTTGGgcTATACACCTACAGAGTAATAATGTTGCAGTT, SHMT1‐ΔP1‐R: GTGTATAgcCCAAGAGCAGACACTTTATTATTATTATTT.
Hieff clone one step cloning kit
Manufactured by Yeasen
Sourced in United States
The Hieff Clone One Step Cloning Kit is a laboratory tool designed for the efficient cloning of DNA fragments. It provides a simple and streamlined process for seamlessly assembling DNA segments into a vector in a single reaction.
Automatically generated - may contain errors
Lab products found in correlation
Pcdh mscvmcs ef1α gfp puro, by System Biosciences (3 mentions)
Hieff mut site directed mutagenesis kit, by Yeasen (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Site directed mutagenesis kit, by Yeasen (1 mentions)
Gel extraction kit, by Omega Bio-Tek (1 mentions)
Lenticrispr v2 vector, by Addgene (1 mentions)
Tet plko puro, by Addgene (1 mentions)
Sodium arsenate, by Merck Group (1 mentions)
Dulbecco phosphate buffered saline (dpbs), by Thermo Fisher Scientific (1 mentions)
Snap cell 647 sir, by New England Biolabs (1 mentions)
Starprep gel extraction kit starprep, by GenStar (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (1 mentions)
Paraformaldehyde (pfa), by Merck Group (1 mentions)
Hela cell, by American Type Culture Collection (1 mentions)
Vectashield antifade mounting medium, by Vector Laboratories (1 mentions)
Q5 dna polymerase, by New England Biolabs (1 mentions)
Plvx tre3g vector, by Takara Bio (1 mentions)
8 protocols using hieff clone one step cloning kit
1
HOXD8 Mutant Plasmid Construction and Luciferase Assay
2
Genetic Engineering of CaMKIIγ and FOXO3a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human CaMKIIγ coding sequence (NM_172171.2) or FOXO3a coding sequence (NM_001455.3) with a 3×FLAG sequence and a kozak sequence was cloned into the vector pCDH-MSCV-MCS-EF1α-GFP+Puro (System Biosciences, Palo Alto, CA, USA) using Hieff Clone™ One Step Cloning Kit (Yeasen, Shanghai, China). Point mutation of CaMKIIγ T287A was produced using Hieff Mut™ Site-Directed Mutagenesis Kit (Yeasen, Shanghai, China) with pCDH-MSCV-CaMKIIγ+3×FLAG-EF1α-GFP+Puro as template, and the primers as follows (mutated base in lower case): forward, 5’-TCGTCA GGAGgCTGTGGAGTGTTTGCGCAAGTTCAATGCCCG-3’; revese, 5’-CACT CCACAGCCTCCTGACGATGCATCATGGATGCCACCGTG-3’.
For knockout of CaMKIIγ, we used CRISPR/Cas9 system. Two seperate sgRNAs against CaMKIIγ were designed and cloned into lentiCRISPR V2 vector (Addgene plasmid # 52961, Cambridge, MA, USA) following the the CRISPR protocol [57 (link)]. Then we evaluated them in HEK293 cells for their ability to knockdown CaMKIIγ. The sequence of the more efficacious sgRNA to target CaMKIIγ as follows: 5’-CACCGTGCTTTCTCTGTGGTCCGC-3’; 5’-AAACGC GGACCACAGAGAAAGCAC-3’.
For knockout of CaMKIIγ, we used CRISPR/Cas9 system. Two seperate sgRNAs against CaMKIIγ were designed and cloned into lentiCRISPR V2 vector (Addgene plasmid # 52961, Cambridge, MA, USA) following the the CRISPR protocol [57 (link)]. Then we evaluated them in HEK293 cells for their ability to knockdown CaMKIIγ. The sequence of the more efficacious sgRNA to target CaMKIIγ as follows: 5’-CACCGTGCTTTCTCTGTGGTCCGC-3’; 5’-AAACGC GGACCACAGAGAAAGCAC-3’.
3
Cloning and Mutagenesis of c-Myc
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The complete coding region of human c‐Myc (NM_002467) was used. Full‐length c‐Myc and five c‐Myc deletion mutants comprising amino acids 1–143, 1–320, 1–328, 329–439, and 355–439 were inserted into pcDNA3.1(‐), using flanking primers containing restricted enzyme sites (BamHI and EcoRI) and HA‐tag. Full‐length c‐Myc was also inserted into pCDH‐CMV‐MCS‐EF1a‐Puro (SBI, CD510B‐1) and pLVX‐EF1α‐mCherry‐N1 (Youbio, VT2012) to generate pCDH‐CMV‐c‐Myc‐flag and pLVX‐EF1α‐c‐Myc‐mCherry. shRNA sequences against c‐Myc were inserted into Tet‐pLKO‐puro (Addgene, 21915) to generate c‐Myc knockdown plasmids. All plasmids were constructed using HieffClone One Step Cloning Kit (YEASEN, 10911). Point mutations of c‐Myc (L297A, A321del, L333A, R346A, S347A, E351A, V361A, and Q365A) were generated using Hieff Mut Site‐Directed Mutagenesis Kit (YEASEN, 11003ES10). Target sequences for c‐Myc‐shRNA1 (5’‐GCTTCACCAACAGGAACTATG‐3’) and c‐Myc‐shRNA2 (5’‐GGAACTATGACCTCGACTACG‐3’) were selected using Thermo scientific RNAi designer. All constructs were verified by sequencing. All plasmids used are available from the authors.
4
Fluorescence Microscopy in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following reagents were purchased from the indicated companies. Lipofectamine 3000 (Thermo); Ribonucleoside Vanadyl Complex (NEB); VECTASHIELD Antifade Mounting Medium (Vector Lab); Cyanine 3-dUTP (Enzo life); DAPI (Invitrogen); Triton X-100 (ABCONE); Agarose (ABCONE); DPBS (Gibco); Paraformaldehyde (Sigma-Aldrich); Sodium arsenate (Sigma-Aldrich); Bovine Serum Albumin (ABCONE); Hieff Clone™ One Step Cloning Kit (Yeasen), and StarPrep Gel Extraction Kit StarPrep (Genstar); DMEM (Gibco); Opti-MEM (Gibco), Fetal Bovine Serum (FBS) (Gibco), SNAP-Cell 647-SiR (NEB), dye Halotag-549 was a gift of Hanhui Ma lab.
HeLa cells were purchased from the American Type Culture Collection (ATCC;http://www.atcc.org ).
HeLa cells were purchased from the American Type Culture Collection (ATCC;
5
Cloning Luciferase Reporter Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding region of firefly luciferase was excised from the pGL3-basic vector using HindIII and XbaI and was inserted into a pcDNA3.1 vector digested with the same restriction enzymes. DNA oligos containing KpnI, ClaI and AgeI restriction sites were then inserted into the XbaI site to generate the pcDNA3.1-Luc vector. The 5ʹ half of the 3ʹ UTR of Dcp2 was amplified from mouse genomic DNA using Q5 DNA polymerase (NEB, Ipswich, MA, USA) and was cloned into the pcDNA3.1-Luc vector using a Hieff Clone One Step Cloning Kit (Yeasen) with the primers Dcp2-5ʹ-half-F and Dcp2-5ʹ-half-R (Table 1) to generate the pcDNA3.1-Luc-Dcp2-5ʹ-half (Luc-5ʹhalf) reporter. The amplified fragment of the 3ʹ half of the 3ʹ UTR of Dcp2 was inserted into the pcDNA3.1-Luc vector digested with KpnI and AgeI with the primers Dcp2-3ʹ-half-F and Dcp2-3ʹ-half-R (Table 1) to generate the pcDNA3.1-Luc-Dcp2-3ʹ-half (Luc-3ʹ-half) reporter. The sequences of both plasmids were confirmed by sequencing.
6
Cloning and Tagging of WTIP and FOXO3a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The WTIP coding sequence with a 3×FLAG-tagged sequence was amplified from HEK293 cells, and then cloned into the pLVX-tre3G vector (Clontech, CA, USA) or pCDH-MSCVMCS-EF1α-GFP+Puro (System Biosciences, Palo Alto, CA, USA) using Hieff CloneTM One Step Cloning Kit (Yeasen, Shanghai, China) as previously described [21 (link)]. The FOXO3a coding sequence with a 3×FLAG-tagged sequence was amplified from HEK293 cells, and cloned into the pCDH-MSCVMCS-EF1α-GFP+Puro (System Biosciences, Palo Alto, CA, USA) using Hieff CloneTM One Step Cloning Kit as previously described [23 (link)]. The sequence of shRNAs for WTIP was designed (shWTIP target sequence: 5′-CCGGCAGCGTGTGTGGACATCTCATCTCGAGATGAGATGTCCACACACGCTGTTTTTG-3′).
7
Overexpressing CaMK2G in Human Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human CaMK2G coding sequence (NM_172171.2) with a 3×FLAG sequence and a kozak sequence was cloned into the vector pCDH-MSCV-MCS-EF1α-GFP+Puro (System Biosciences, USA) using Hieff Clone TM One Step Cloning Kit (Yeasen, China) [26 (link)].
CRISPR/Cas9 system was applied to construct cells with CaMK2G knockout. Lentivirus vector pCW-Cas9 (doxycycline inducible; #5066) and pLX-sgRNA (lentiviral vector, #50662) were purchased from Addgene (USA). Two seperate sgRNAs against CaMK2G were designed and cloned into pLX-sgRNA following the the CRISPR protocol [37 (link)]. The sequence of two seperate sgRNA against CaMK2G as follows: 5’-CACCGTGCTTTCTCTGTGGTCCGC-3’; 5’-AAACGCGGACCACAGAGAAAGCAC-3’.
CRISPR/Cas9 system was applied to construct cells with CaMK2G knockout. Lentivirus vector pCW-Cas9 (doxycycline inducible; #5066) and pLX-sgRNA (lentiviral vector, #50662) were purchased from Addgene (USA). Two seperate sgRNAs against CaMK2G were designed and cloned into pLX-sgRNA following the the CRISPR protocol [37 (link)]. The sequence of two seperate sgRNA against CaMK2G as follows: 5’-CACCGTGCTTTCTCTGTGGTCCGC-3’; 5’-AAACGCGGACCACAGAGAAAGCAC-3’.
8
Cloning VDR ORF into pIPFlag Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hieff CloneTM One Step Cloning Kit (Yeasen, 10911ES25) was used to clone the ORF sequence of VDR into the pIPFlag-tagged vector with Flag-tag in the N-terminus according to the protocol. The non-targeting control shRNA (shNT) and YAP1-targeting shRNAs used in this research were purchased from Biochemistry and Molecular Cell Biology, Shanghai Jiao Tong University School of Medicine. Primers for plasmids constructions and shRNA sequences were listed in Supplementary Table S2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!