Ez first strand cdna synthesis kit

Total RNA was isolated from untreated Arabidopsis plants and from plants 24 to 72 h posttreatment with 10⁸P. aphidis spores/mL using a Qiagen RNeasy kit (Invitrogen, San Diego, CA) according to the manufacturer’s instructions or using the LogSpin method (84 (link)). DNase treatment was performed on Qiagen columns according to the manufacturer’s instructions (Invitrogen). Total RNA (1 μg) was reverse-transcribed with an EZ-First strand cDNA synthesis kit (Biological Industries, Israel). qRT-PCR was performed with SYBR master mix and a StepOne real-time PCR machine (Applied Biosystems, Foster City, CA). The thermal cycling program was as follows: 95°C for 20 sec, 40 cycles of 95°C for 3 sec, and 60°C for 30 sec. Relative fold changes in gene expression normalized to AtEF1α levels in samples from treated versus untreated leaves were calculated by the 2^−ΔΔCt method. The primer sequences used were AtPTB1F′ GATCTGAATGTTAAGGCTTTTAGCG, AtPTB1R′ GGCTTAGATCAGGAAGTGTATAGTCTCTG, WRKY11F′ CCACCGTCTAGTGTAACACTCGAT, WRKY11R′ TGCAACGGAGCAGAAGCAAGGAA, MYB51F′ ACAAATGGTCTGCTATAGCT, MYB51R′ CTTGTGTGTAACTGGATCAA, AT5G25260F′ TCGTGTTCTCGCTGCTTCCA, AT5G25260R′ GGCACGTCAACGAGCTGTTT, PEN2F′ TAACATGCTTCTAGCGCACGCAG, PEN2R′ CATCTGGATCACTCGGATCATATG.

Total RNA was isolated from untreated Arabidopsis plants and from plants 24 to 72 h posttreatment with 10⁸P. aphidis spores/mL using a Qiagen RNeasy kit (Invitrogen, San Diego, CA) according to the manufacturer’s instructions or using the LogSpin method (84 (link)). DNase treatment was performed on Qiagen columns according to the manufacturer’s instructions (Invitrogen). Total RNA (1 μg) was reverse-transcribed with an EZ-First strand cDNA synthesis kit (Biological Industries, Israel). qRT-PCR was performed with SYBR master mix and a StepOne real-time PCR machine (Applied Biosystems, Foster City, CA). The thermal cycling program was as follows: 95°C for 20 sec, 40 cycles of 95°C for 3 sec, and 60°C for 30 sec. Relative fold changes in gene expression normalized to AtEF1α levels in samples from treated versus untreated leaves were calculated by the 2^−ΔΔCt method. The primer sequences used were AtPTB1F′ GATCTGAATGTTAAGGCTTTTAGCG, AtPTB1R′ GGCTTAGATCAGGAAGTGTATAGTCTCTG, WRKY11F′ CCACCGTCTAGTGTAACACTCGAT, WRKY11R′ TGCAACGGAGCAGAAGCAAGGAA, MYB51F′ ACAAATGGTCTGCTATAGCT, MYB51R′ CTTGTGTGTAACTGGATCAA, AT5G25260F′ TCGTGTTCTCGCTGCTTCCA, AT5G25260R′ GGCACGTCAACGAGCTGTTT, PEN2F′ TAACATGCTTCTAGCGCACGCAG, PEN2R′ CATCTGGATCACTCGGATCATATG.