White 384 well plates

Manufactured by Roche

The White 384 well plates are a common laboratory tool used for a variety of assays and experiments. They provide a standardized platform with 384 individual wells, enabling high-throughput sample processing and analysis. The plates are white in color, which can enhance signal detection in certain applications.

Automatically generated - may contain errors

Lab products found in correlation

Lc 480 2 system, by Roche (4 mentions) Lightcycler 480 sybr green master, by Roche (3 mentions) 7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions) Tissue tearor, by Biospec (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Transcriptor first strand cdna synthesis kit, by Roche (1 mentions) Lightcycler 480, by Roche (1 mentions) Rneasy extraction kit, by Qiagen (1 mentions) Handheld homogeniser, by Cole-Parmer (1 mentions) Random hexamer, by Thermo Fisher Scientific (1 mentions) Transcriptor reverse transcriptase, by Roche (1 mentions) Tripure, by Roche (1 mentions) Dntps, by Roche (1 mentions)

5 protocols using white 384 well plates

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qPCR analysis, cDNA (5 ng) and primer pairs (1 μM, see table 18, available at http://links.lww.com/PAIN/A676) were mixed with LightCycler 480 SYBR Green Master (Roche) in a 1:1 ratio and added to white 384-well plates (Roche). Plates were run on a 45-cycle protocol using the LC 480 II system (Roche). Gene expression for each mouse target primer was normalized against the reference gene HPRT1, and the relative expression (delta CT) was calculated. For human IPS cells, transcript expression was normalised against the average CT of GAPDH and HPRT1. For each target, transcript expression is shown relative to a control group (eg, Sham). Significance was calculated using ANOVA with a design of ∼ sex + condition for each mouse strain and ∼ condition for human IPSC averaging over all cell lines. N = 10 per strain (6 Sham–4 SNI for BALB/c, 5 Sham–5 SNI for B10.D2; for strand-specific qPCR, B10.D2 strain N =8, 5 Sham–3 SNI). Quantitative real-time polymerase chain reaction was also used to assess relative mRNA expression in brain vs DRG, N = 3. Significance was calculated using 1-way ANOVA.

Baskozos G., Dawes J.M., Austin J.S., Antunes-Martins A., McDermott L., Clark A.J., Trendafilova T., Lees J.G., McMahon S.B., Mogil J.S., Orengo C, & Bennett D.L. (2018). Comprehensive analysis of long noncoding RNA expression in dorsal root ganglion reveals cell-type specificity and dysregulation after nerve injury. Pain, 160(2), 463-485.

+ Open protocol

+ Expand

mRNA Expression Analysis by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

For analysis of mRNA expression using SYBR green cDNA (5ng) and primers (0.5μM) were mixed with LightCycler 480 SYBR Green Master (Roche) in a 1:1 ratio and added to white 384 well plates (Roche). Plates were run on a 45 cycle protocol using the LC 480 II system (Roche). Primers were designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Primer efficiency and specificity were validated before experimental use. Gene expression for each target primer was normalized against 3 reference genes (18 s, GAPDH and HPRT1) using the delta delta CT method. Primer sequences are shown in Table S8. For mRNA expression analysis by means of Taqman technology, custom-made microfluidic Taqman array cards were designed. These cards contained primers and probes to detect a number of pain-related genes as well as 3 reference genes (18 s, GAPDH and HPRT1). Each cDNA sample was diluted in PCR grade water and added to Taqman Universal master mix to produce a final concentration of 1-4ng/μl. Cards were run on a 7900HT Fast Real-Time PCR system (Applied Biosystems) and gene expression calculated using the delta delta CT method. Assay IDs are shown in Table S8.

Dawes J.M., Weir G.A., Middleton S.J., Patel R., Chisholm K.I., Pettingill P., Peck L.J., Sheridan J., Shakir A., Jacobson L., Gutierrez-Mecinas M., Galino J., Walcher J., Kühnemund J., Kuehn H., Sanna M.D., Lang B., Clark A.J., Themistocleous A.C., Iwagaki N., West S.J., Werynska K., Carroll L., Trendafilova T., Menassa D.A., Giannoccaro M.P., Coutinho E., Cervellini I., Tewari D., Buckley C., Leite M.I., Wildner H., Zeilhofer H.U., Peles E., Todd A.J., McMahon S.B., Dickenson A.H., Lewin G.R., Vincent A, & Bennett D.L. (2018). Immune or Genetic-Mediated Disruption of CASPR2 Causes Pain Hypersensitivity Due to Enhanced Primary Afferent Excitability. Neuron, 97(4), 806-822.e10.

+ Open protocol

+ Expand

Tissue RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissue was homogenized using a Tissue Tearor (Biospec, Bartlesville, OK) and processed using the Qiagen RNeasy extraction kit as per instructions. Briefly, tissue was homogenized in 1ml Trizol (Life Technologies, Carlsbad, CA), 200ul of chloroform was added, tubes vortexed, samples were spun for 10′ at 15,000rpm and top aqueous layer was removed and put into a new tube (~600ul). A similar amount of 70% ethanol was mixed into samples and then 700ul was applied to the RNEasy columns. Columns were spun at 15,000rpm for 1′, flow through discarded, and procedure repeated with second half of sample. 700ul of Buffer RW1 was added to the column, spun for 1′ at 15,000rpm and flow through discarded. 2 washes were conducted using 500ul of buffer RPE and RNA eluted using 50ul of water. RNA quantity was assayed using a Biodrop (Biodrop, Cambridge, UK) and 1ug of total RNA was reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). Real-time quantitative PCR was done on a Roche 480 Light cycler as per kit instructions (Roche, Basel, Switzerland) using a total volume of 10ul/well on white 384 well plates (Roche, Basel, Switzerland).

Ravussin Y., Edwin E., Gallop M., Xu L., Bartolomé A., Kraakman M.J., LeDuc C.A, & Ferrante AW J.r. (2018). Evidence for a non-leptin system that defends against weight gain in overfeeding. Cell metabolism, 28(2), 289-299.e5.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qPCR analysis, cDNA (5ng) and primer pairs (1μM, See table 18) were mixed with LightCycler 480 SYBR Green Master (Roche) in a 1:1 ratio and added to white 384 well plates (Roche). Plates were run on a 45-cycle protocol using the LC 480 II system (Roche). Gene expression for each mouse target primer was normalized against the reference gene HPRT1 and the relative expression (delta CT) calculated. For human IPS cells transcript expression was normalised against the average CT of GAPDH and HPRT1. For each target transcript expression is shown relative to a control group (e.g. Sham). Significance was calculated using ANOVA with a design of ~ sex + condition for each mouse strain and ~ condition for human IPSC averaging over all cell lines. N= 10 per strain (6 Sham 4 SNI for BALB/c, 5 Sham - 5 SNI for B10.D2, for strand specific qPCR B10.D2 strain N =8, 5 Sham – 3 SNI. qPCR was also used to assess relative mRNA expression in brain vs DRG, N=3. Significance was calculated using one-way ANOVA.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Sciatic Nerve

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fresh sciatic nerves were collected, immediately frozen in liquid nitrogen and stored at −80C. Tissues were then homogenised in TriPure (Roche) with a handheld homogeniser (Cole‐Parmer), treated with chloroform and purified with a High Pure Tissue Kit (Roche). RNA was eluted in RNase free water and cDNA was synthesised using a Transcriptor reverse transcriptase (Roche), random hexamers (Invitrogen) and dNTPs (Roche). cDNA amplification (5 ng) was done using the LighCycler 480 SYBR Green Master (Roche) and primers (0.5 μM). White 384 well plates (Roche) were run for 45 cycles in a LC 480 II system (Roche). MME primers were designed using Primer‐BLAST (https://www.ncbi.nlm.nih.gov/tools/primer‐blast/) and validated before the experiment. The MME primer used for KO mice was specifically designed in order to include exons 12 and 13 that were modified to obtain the KO mouse model: CAGCCTCAGCCGAAACTACA (forward primer) and ACATAAAGCCTCCCCACAGC (reverse primer). Gene expression was normalized against three reference genes (GAPDH, HPRT1, and 18S) and calculated by the ΔΔCt method.

Cervellini I., Galino J., Zhu N., Fricker F.R., Bao L, & Bennett D.L. (2019). Membrane metallo‐endopeptidase is dispensable for repair after nerve injury. Glia, 67(10), 1990-2000.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!