The largest database of trusted experimental protocols

Pspax2

Manufactured by Addgene
Sourced in United States, Switzerland, China, Japan, Germany, United Kingdom, France, Canada

PsPAX2 is a packaging plasmid used for the production of lentiviral particles. It contains the necessary genes for lentiviral packaging, but does not contain the viral genome. PsPAX2 is commonly used in lentiviral production workflows.

Automatically generated - may contain errors

2 585 protocols using pspax2

1

Isolation of Extracellular Vesicles and Viral-Like Particles

Check if the same lab product or an alternative is used in the 5 most similar protocols
EVs isolated from thirty ml of conditioned medium were collected from cells cultured at 70% confluency in two 100 mm plates after 72 h (seeding density 2.2 × 106 cells/plate). The conditioned media was centrifuged at 300 × g for 10 min to remove intact cells, dead cells, and cell debris. The medium was then concentrated using a centrifugal concentrator with a 100,000 molecular-weight cutoff (Amicon®Ultra-15 Centrifugal filters), yielding about 0.5 ml concentrate (two spins of 10 ml at 6000 × g for 10 min). This concentrate was resolved by passing through IZON qEV original size exclusion columns (SEC) followed by 15 ml of double filtered (0.2 μm) PBS. Five-hundred-microliter fractions were collected. High particle/low protein fractions (from 7 to 11) were pooled and concentrated using Amicon®Ultra-0.5 Centrifugal filters to a final volume of 200 µL at 10,000 × g for 30 min. The typical yield of an EV isolation was approximately 7.1 × 107 ± 3.2 × 107 particles/ml. This method was adapted to isolate EVs, LVVs (transgene plasmid, psPAX2 (Addgene #12260) and pMD2.G (#12259), VSV G-VLPs (pMD2.G (Addgene #12259), and GAG-VLPs (psPAX2 (Addgene #12260)) before being exposed to scProteins (see below). LVVs purified from media of 2.5 million HEK293Tcells transfected with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) were isolated with SEC.
+ Open protocol
+ Expand
2

Lentiviral Transduction for shRNA and CRISPR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus expressing shRNA was produced by co-transfecting HEK293T cells with a mixture of shZNF384 or shControl plasmid, the Gag-Pol packaging plasmid psPAX2 (Addgene, cat#12260), and the envelope plasmid pMD2G (Addgene, cat#12259) at a 4:3:2 ratio using Lipofectamine 2000 transfection (lip2000) reagent (Thermo Fisher, cat#11668019). Lentivirus expressing sgRNA and cas9 was produced by co-transfecting HEK293T cells with a cocktail of gRNA/Cas9-expressing lentiCRISPRv2, Gag-Pol packaging plasmids, including psPAX2 (Addgene, cat#12260), and B19/VSVG (Addgene, cat#88865) at a ratio of 3:4:1 using lip2000 reagent. Virus particles were harvested 48 h after transfection. Lentivirus-infected cells were screened with the corresponding concentration of puromycin (Thermo Fisher, cat#A1113802: Huh7, 1 µg/µl; PLC/PRF/5, 1 µg/µl; HCCLM3, 10 µg/µl).
+ Open protocol
+ Expand
3

Lentivirus Production and Transduction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus stocks were produced as previously described with slight modifications. Human embryonic kidney 293FT cells (Invitrogen) were transfected using Lipofectamine 2000 (Thermo Fisher) with the expression of two helper plasmids: psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) Ten micrograms of the transfer vector, 5 µg psPAX2 and 5 µg pMD2.G of DNA were used per 10‐cm plate. Forty‐eight hours after transfection, the supernatants of four plates were pooled, centrifuged at 780 × g for 5 min, filtered through a 0.45‐µm pour size filter, and further centrifuged at 24 000 rpm for 2 h. The resulting pellet was re‐suspended in 100 µL of PBS. Lentivirus titration was performed on DIV5‐6 at titer range 107 IU/mL. In most experiments, cultures were infected overnight, rinsed twice with virus‐free medium the next morning and incubated in normal culturing medium for another 48–72 h prior assay.
+ Open protocol
+ Expand
4

Overexpression and Knockdown of Lhx8 and Suv39h1 in DPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the overexpression of Lhx8 or Suv39h1, the open reading frames of target genes were amplified and the amplicon was inserted into the lentivirus expression vector of pWPI (Plasmid #12254; Addgene). A lentivirus was produced through transfecting HEK293T cells with the lentivirus expression vector along with pMD2.G (Plasmid #12259, Addgene) and psPAX2 (Plasmid #12260, Addgene) (pWPI 6.25 μg, pMD2.G 0.625 μg and psPAX2 3.125 μg). Supernatants containing lentivirus particles were then collected after 48 hours and were stored at −80°C before use. DPSCs were infected with a lentivirus in 8 μg/mL polybrene (Santa Cruz Biotechnology). DPSCs were transfected with the lentivirus or the negative control according to Multiplicity of Infection (MOI) 50:1 for 2 days.
For shRNA knockdown of Lhx8 or Suv39h1 in DPSCs, lentiviral shRNAs were purchased from GenePharma. Five shRNAs were used for lentiviral treatment. DPSCs were transfected with the lentiviral‐mediated shRNA or the negative control according to Multiplicity of Infection (MOI) 50:1 for 2 days. Compared with the non‐silencing scramble virus, the shRNAs with the highest knockdown efficiencies were chosen for follow‐up experiments. The chosen sequences were listed in Supplemental Table S1.
+ Open protocol
+ Expand
5

Generation of Viral Expression Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
pcDNA-3xFLAG-Vpr and pscAAV-mCherry-T2A-Vpr WT and mutant plasmids were generated as previously described (28 (link)). For rAAV production, pHelper and pAAV-2.5 capsid plasmids were used (Addgene and (28 (link)). For VLP production, psPAX2 and pmD2.G were used (Addgene). For HIV-1 ΔENV production, Bru-GFP ΔENV was generated as previously described (62 (link)) and pmD2.G (Addgene). For lentivirus stable knock-down of DCAF1, pLKO.1 (Addgene), psPAX2(Addgene) and pmD2.G (Addgene) were used.
+ Open protocol
+ Expand
6

Generating Gene Knockout Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate the gene knockouts, tetracycline induced cas9 vector (Addgene # 50661) was stably expressed in prostate cancer lines. sgRNAs against target genes given in were cloned in pLXsgRNA vector (Addgene# 50662), and lentiviral particles for sgRNA were produced in HEK293T cells by co-transfecting pLXsgRNA plasmid with pMD2.G (Addgene# 12259) and psPAX2 (Addgene #12260). (Supplementary Table S1A) Viruses were harvested after 48h, and cells were infected with lentiviral particles. Transduced cells were treated with 1 μg/mL doxycycline to induce cas9 before selection with 10 μg/mL blasticidin. Following selection, cells were transferred in 96-well plates to select individual clones. Knockouts were verified by western blots, and confirmed clones were expanded and cryopreserved for future experiments.
For NCOA4 knockdown in LNCaP cells, MISSION shRNA constructs (TRCN0000236184, TRCN0000236186, TRCN0000236187, TRCN0000236188 and TRCN000019724) were purchased from Sigma, and lentiviral particles were generated in HEK293T cells by co-transfecting shRNA plasmid construct with pMD2.G (Addgene#12259) and psPAX2 (Addgene#12260). LNCaP cells were infected with NCOA4 lentivirus and were selected with 1.0 μg/mL puromycin. The level of NCOA4 knockdown was measured by western blots, and confirmed cells were expanded, cryopreserved, and used for the experiments.
+ Open protocol
+ Expand
7

Silencing Protein Expression using Lentiviral shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Protein expression silencing was done by lentiviral shRNA. Mission shRNA (Sigma Aldrich) was co-transfected with pLKO.1-shRNA-Control or pLKO.1-shRNA-1:(CCGGCAAGTTCCACATTGGTATCAACTCGAGTTGATACCAATGTGGAATTGGTATCAACTCGAGTTGATACCAATGTGGAACTTGTTTTTTG), together with pSMD.G and psPAX-2 (Addgene) packaging vectors (4.5 μg shRNA, 3 μg, psPAX-2, 1.5 μg psMD.G with 30 μL PolyJet DNA In Vitro Transfection Reagent) into a 10 cm plate to make virus. The medium was changed 6 h later. Forty-eight hours after transfection, the viral supernatant was collected, centrifuged at 3000 x g for 10 min and added to ~50% confluent control and HEK293A cells with 8 μg/mL polybrene (#AL-118 from Sigma Aldrich). Sixteen hours after transfection the medium was again changed and puromycin (#ant-pr-1 from Invitrogen) added to a final concentration of 5 μg/mL. Under these conditions, non-infected cells died within 24 h. shRNA used for human PKA Catα (PRKACA) from Sigma:
+ Open protocol
+ Expand
8

Lentiviral Vector Production and Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols
MT-4 T cells were cultured in RPMI 1640 (Nacalai Tesque) with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin, while 293T cells were cultured in Dulbecco’s modified Eagle medium (DMEM) (Nacalai Tesque) with 10% FBS. The development of stable Tat- and Rev-expressing 293T cells was described previously [19 (link)]. Vesicular stomatitis virus G (VSVG)-pesudotyped lentiviral vectors were produced by co-transfecting gRNA-Cas9-expressing pLentiCRISPRv2, psPAX2 (Addgene #12260), and pHIT/G [38 (link)] at a ratio of 3:4:1 into packaging Lenti-X 293T cells (Takara-Bio) using a FuGENE HD transfection reagent (Promega). Transduction into MT-4 cells was performed with an multiplicity of infection (MOI) of 10 (as determined previously [19 (link)]) for all single gRNA as well as the all-in-one multiplexed vectors (tat-3, rev-3, and tatrev-6), an MOI of 3.33 for each gRNA in tatABC and revABC, and an MOI of 1.67 for each gRNA in tatrevABC. To determine the lentiviral titer, a preliminary transduction assay into 293T cells was done using VSVG-pseudotyped lentivirus expressing green fluorescent protein (GFP) that was generated by co-transfecting pWPT-GFP (Addgene #12255), psPAX2, and pHIT/G, and the MOI was then determined via GFP expression (Figure S1). Cells were selected one day after transduction with 1 μg/mL of puromycin for two weeks.
+ Open protocol
+ Expand
9

Silencing Protein Expression via Lentiviral shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Protein expression silencing was done by lentiviral shRNA. Mission shRNA (Sigma Aldrich) was co-transfected with pLKO.1-shRNA-Control or pLKO.1-shRNA-1: (CCGGCAATAAGCAACAGAT GATATTCTCGAGAATATCATCTGTTGCTTATTGTTTTTG), together with pSMD.G and psPAX-2 (Addgene) packaging vectors (4.5 μg shRNA, 3 μg psPAX-2, 1.5 μg psMD.G with 30 μL PolyJet DNA In Vitro Transfection Reagent) into a 10 cm plate to make virus. The medium was changed 6 h later. Forty-eight hours after transfection, the viral supernatant was collected, centrifuged at 3000 x g for 10 min and added to ~50% confluent control and HEK293A cells with 8 μg/mL polybrene (#AL-118 from Sigma Aldrich). Sixteen hours after transfection the medium was again changed and puromycin (#ant-pr-1 from Invitrogen) was added to a final concentration of 5 μg/mL. Under these conditions, non-infected cells died within 24 h. shRNA used for human AKAP13 from Sigma:
TRCN0000296007:CCGGCAATAAGCAACAGATGATATTCTCGAGAATATCATCTGTTGCTTATTGTTTTTG
TRCN0000296006:CCGGTGAGAATGCAGAACGTTTAAACTCGAGTTTAAACGTTCTGCATTCTCATTTTTG
TRCN0000037971:CCGGGCTGAAGATGATGTAGTGTTTCTCGAGAAACACTACATCATCTTCAGCTTTTTG
TRCN0000037972:CCGGGCAGTTCTTCTCACTGACATTCTCGAGAATGTCAGTGAGAAGAACTGCTTTTTG
+ Open protocol
+ Expand
10

Lentivirus Production for CRISPR Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus production was described previously 12 . Briefly, for individual sgRNA packaging, 1.2 μg of gRNA expressing plasmid, 0.9 μg of psPAX2 and 0.3 μg of pMD2.G (Addgene) were transfected into HEK293T cells by Lipofectamine 2000 (Life Technologies). Medium were changed 8 hours after transfection.
After 48h, virus supernatants were collected. For library packaging, 12 μg of plasmid library, 9 μg of psPAX2, and 3 μg of pMD2.G (Addgene) were transfected into a 10-dish HEK293T cells with 60 μl of Lipofectamine 2000.
Virus were harvested twice at 48 h and 72 h post-transfection. The virus was concentrated using PEG8000 (no. LV810A-1, SBI, Palo Alto, CA), dissolved in PBS and stored at -80 °C.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!