Ex taq enzyme

The complete genomes of two of the earliest NoVs—JB031230049 and JB031230054—were amplified. Initially, cDNA was reverse transcribed from viral RNA (9.5 μL) using a modified oligo(dT)₂₀ primer (V₃NT₂₀ in Table 1) and a SuperScript III first-strand synthesis system (Invitrogen, Carlsbad, CA). The total, 50-μL reaction mixture contained 5 μL 5× Ex Taq Buffer, 1 μL of each primer (20 pmol), 1 μL dNTP mix (10 mM), 0.5 μL Ex Taq enzyme (Takara, Japan), 5 μL cDNA, and 36.5 μL RNase-free water. CoG2F [45 (link)]and V₃NT₂₀ [46 (link)] primers were used to amplify the fragment from the ORF2 to the 3’ Poly A. The cycling conditions were configured as follows: initial denaturation at 94°C for 3 min, followed by 40 amplification cycles (94°C for 15 s, 62°C for 3 min, and 72°C 30s) and a final extension step at 72°C for 15 min. The ORF1 was divided into five overlapping fragments, which were amplified using the P290 and G2-SKR primers and four pairs of newly designed primer sets (Table 1). The conditions were as follows: initial denaturation at 94°C for 3 min, then 35 cycles (94°C for 45 s, 55°C for 45 s, and 72°C 1 min), and a final extension at 72°C 10 min. The fragment covering the ORF1/ORF2 overlap and amplified by the P290 [47 (link)] and G2-SKR [45 (link)] primers was also used to examine potential recombination.

The genomic DNA of P. volubilis was extracted using the modified CTAB method, and the integrity of the genomic DNA was examined using 1% agarose gel electrophoresis. Full-length cDNA and genomic sequences of PvFAD3 were amplified from P. volubilis with FAD3-F and FAD3-R (Supplementary Table S1) as primers. The primers were designed based on the transcript sequence of the PvFAD3 (Unigene0043398) in P. volubilis seed transcriptome (SRR8205220). The PCR reaction system included 1.5 µL of the forward primer, 1.5 µL of the reverse primer, 25 µL of 2× Ex Taq buffer, 1 µL of dNTP (10 mmol·L⁻¹), 5 µL of cDNA, 1 µL of Ex Taq enzyme (5 U/µL, TaKaRa Bio, Beijing, China), and 15 µL of ddH₂O. The reaction procedure was as follows: predenaturation at 94 °C for 2 min, denaturation at 94 °C for 30 s, annealing at 53 °C for 30 s, extension at 72 °C for 1 min, for 35 cycles; hold at 72 °C for 10 min, store at 4 °C. The PCR products were subjected to agarose gel electrophoresis, recovered, ligated into the pMD19-T vector (Takara, Dalian, China), and sequenced by transforming the positive clones obtained from Escherichia coli.

DNA inserts were amplified from phagemids using TaKaRa Ex Taq enzyme at a Tm of 56 °C and primers Ff: CGT CGGCAGCGTCAGATGTGTATAAGAGACAGGAG GCTAGCAACGCGTCG and Rev: GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAGCCAGGCGCGCCG. They bind very close to the insert and contain the Illumina MiSEQ sequencing platform adapters (underlined). High-throughput sequencing on gel-purified amplicons was done by Inqaba Biotech (South Africa) using the Illumina MiSEQ v3 (150 cycles) platform.

For microscopic visualization of exogenous DNA binding, we used a fluorescently-labeled 1,5 kb PCR fragment corresponding to the amplification of the amyE gene. PCR reactions were performed as explained in ref. ^{31 (link)}. Briefly, we used 1 µl of ExTaq enzyme from Takara in 100 µl on genomic DNA (20 ng) with 1 µM of each primer, 0.25 µM of each dNTP and 0.1 µM of ATTO550-aminoallyl-dUTP. Elongation was performed at 72 °C for 3 min per kb. Fragments were purified using Wizard SV Gel and PCR clean-up systems (Promega corporation).
200 ng of ATTO550-labeled DNA was mixed with 100 µl of cells grown for 2 h in SPII medium. The suspension was incubated for 8 min at 37 °C. Cells were then pelleted, washed once with 100 µl of fresh SPII medium and resuspended in 50 µl of fresh SPII medium.

nanoCAGE libraries were constructed from isolated RNA as previously described^{12 (link)}, with some modifications. The reverse-transcription products were eluted in 40 µL, and qPCR was conducted using the SYBR Premix Ex Taq kit (TaKaRa). Cycle numbers were estimated as Ct + 4 cycles, and PCR was conducted to generate cDNA using the Ex Taq enzyme (TaKaRa). PCR products were eluted in 30 μL of sterile distilled water after purification, and 0.3 ng of each sample was tagmented individually at 55 °C for 5 min. The extension time of the final PCR was 30 s, and the final purification was achieved using one volume of AMPure reagent (Beckman Coulter, Inc), with the products eluted in 25 μL of reaction mixture. The multiplexed libraries were then paired-end sequenced in five lanes of a HiSeq 2000 sequencer (Illumina) and aligned to human genome version hg38 supplemented with all the HPV genomes available on the Papillomavirus Episteme database^{37 (link)} on 5 Sep, 2016, using the CAGEscan pipeline v3.0 (https://gitlab.com/mcfrith/cagescan-pipeline, Kratz et al., in preparation), which assembles overlapping pairs originating from the same molecule and maps them to the genome using the LAST aligner^{38 (link)}.

The frozen soil samples were thawed on ice, and DNA was extracted using a PowerSoil DNA Isolation Kit (MO BIO Laboratories, Inc., Carlsbad, USA). 16S rRNA genes were amplified using EXtaq enzyme (TaKaRa, Kyoto, Japan) and the specific primers 314F (5′-CCTACGGGNGGCWGCAG-3′) and 805R (5′-GACTACHVGGGTATCTAATCC-3′) with the adapter (index) that targets the V3 and V4 variable regions of bacterial/archaeal 16S rRNA genes. Strongly amplified products 460 bp in length were chosen for further experiments. The amplicons were quantified with a Qubit 2.0 fluorometer (Thermo Fisher Scientific, USA), diluted to 1 ng/μL, and sequenced on a MiSeq platform (PE250). In total, 854,514 raw reads were obtained from the 18 samples of rhizosphere soils (6 groups as shown in Fig. 1a, n = 3). We computed operational taxonomic units (OTU) and microbial diversity as described previously [52 (link)]. Rarefaction curves of observed species are shown in Additional file 1: Fig. S5.

Wild-type C. elegans (N2), daf-2 (e1370), daf-16 (mu86) and sod-3 (gk235) were provided by the Caenorhabditis Genetics Center (CGC). The mutants sod-5 (tm1146) and Escherichia coli OP50 (Streptomycin⁺) were presented by Professor Mitani S of Tokyo Women’s Medical University. PQ and CM-H2DCFDA probes were purchased from Sigma Company (USA). RNA extraction kits and DNase were purchased from Omega (USA); reverse transcription kits were purchased from Toyobo (Japan); ExTaq enzyme, DNA Marker DL2000, and dNTP Mixture were purchased from TaKaRa (Japan); agarose was purchased from Gene (Hong Kong, China); and GoldView^™ nucleic acid dye was purchased from Solarbio (China).
All strains were maintained and grown on NGM plates seeded with E. coli OP50. NGM plates containing PQ were equilibrated overnight before use. Hydrogen was generated by a hydrogen gas generator SHC-300 (Saikesaisi HW Energy, Shandong, China). The concentration of hydrogen gas was measured by the hydrogen detector HD-P900X-H2 (Jinan Handa Electronics Technology Co. Ltd., Shandong, China).