Log In Sign up
The largest database of trusted experimental protocols

Rna mini kit

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The RNA Mini Kit is a laboratory product designed for the extraction and purification of RNA from various sample types. It utilizes a simple and efficient protocol to isolate high-quality RNA suitable for downstream applications such as RT-PCR, Northern blotting, and RNA sequencing.

Automatically generated - may contain errors

Lab products found in correlation

Steponeplus real time pcr system, by Thermo Fisher Scientific (5 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (5 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (4 mentions) Trizol reagent, by Thermo Fisher Scientific (4 mentions) Trizol, by Thermo Fisher Scientific (4 mentions) Iscript cdna synthesis kit, by Bio-Rad (3 mentions) Kapa sybr green fast qpcr kit, by Roche (3 mentions) Superscript cdna synthesis kit, by Thermo Fisher Scientific (3 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions) Sybr green real time pcr master mix, by Thermo Fisher Scientific (2 mentions) Stepone, by Thermo Fisher Scientific (2 mentions) M mlv reverse transcriptase, by Elpis Biotech (2 mentions) Sybr green, by Thermo Fisher Scientific (2 mentions) Abi 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions) Superreal premix plus, by Tiangen Biotech (2 mentions) Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions) Taqman probe, by Thermo Fisher Scientific (2 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions) Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions) Superscript 3, by Thermo Fisher Scientific (2 mentions)

Close spelling variants of this product

PureLink RNA Mini Kit (3471 citations) PureLink Viral RNA/DNA Mini Kit (138 citations) Ambion PureLink RNA Mini Kit (61 citations) GeneJET Plant RNA Purification Mini Kit (54 citations) PureLink RNA Mini Kit columns (7 citations) Invitrogen PureLink RNA Mini Kit (6 citations) PureLinkr® RNA Mini Kit (4 citations) RNeasy mini RNA extraction kit (3 citations) PureLink RNA Mini assay kit (3 citations) Viral RNA/DNA Mini Kit (3 citations)

57 protocols using rna mini kit

1

Quantitative Gene Expression Analysis by RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells using the RNA mini kit from Ambion according to the manufacturer’s instructions. To determine RNA concentrations, the absorbance at 260 nm was measured. Complementary DNA (cDNA) was obtained from 1 μg of the purified RNA using SuperScript IV Reverse Transcriptase (Invitrogen) in a final volume of 20 μl. For RT-PCR, 4 μl of cDNA (50 ng/reaction) were loaded in triplicates in a 96-well plate and 6 μl of the reaction mix were added. The plate was sealed and centrifuged for 1 min at 200 × g and run as follows: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 15 s, annealing at 56 °C for 15 s, elongation at 72 °C for 60 s, and three final steps of 95 °C for 15 s, 60 °C for 2 min and 95 °C for 15 s. Glyceraldehyde-3-phosphate dehydrogenase was used as a reference and the ΔΔC(t) method was used to quantify gene expression. The primer sequences are presented in Supplementary Table 1.
Slobodnyuk K., Radic N., Ivanova S., Llado A., Trempolec N., Zorzano A, & Nebreda A.R. (2019). Autophagy-induced senescence is regulated by p38α signaling. Cell Death & Disease, 10(6), 376.
+ Open protocol
+ Expand
2

Isolation and RNA Analysis of Mouse Skin Layers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The back skin tissues were dissected from mice, and then floated on trypsin solution (Thermo Scientific, Rockford, IL) at 4°C overnight. Epidermis was separated from dermis using the fine forcep. Total RNA was isolated using RNA mini kit (Ambion, Austin, TX) and reverse-transcribed with moloney-murine leukaemia virus (M-MLV) reverse transcriptase (ELPIS Biotech, Daejeon, Korea). qRT-PCR was performed on Applied Biosystems StepOne with SYBR Green real-time PCR master mix (Applied Biosystems, Foster City, CA) according to the manufacture’s protocol. The relative expression levels of mRNA were determined by the comparative Ct method. The primer sequences were as follows: Crif1 (5’-GCGAAAGCAGAAGCGAGAAC-3’, 5’-GGCCCTCCGCTCCTTGT-3’), Actin (5’-CGATGCCCTGAGGCTCTTT-3’, 5’-TGGATGCCACAGGATTCCA-3’).
Shin J.M., Ko J.W., Choi C.W., Lee Y., Seo Y.J., Lee J.H, & Kim C.D. (2020). Deficiency of Crif1 in hair follicle stem cells retards hair growth cycle in adult mice. PLoS ONE, 15(4), e0232206.
+ Open protocol
+ Expand
3

Quantification of Histamine Receptor Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from HUVEC, HDMEC and HCMEC using the RNA Mini Kit (Ambion, Grand Island, NY) according to the manufacturer's specifications. RNA concentration and purity was determined using NanoVue (GE Healthcare, Pittsburgh, PA). Total RNA was reverse-transcribed into cDNA with 500 ng of total RNA. RT-PCR was performed using TaqMan Master Mix (Applied Biosystems, Carlsbad, CA). Reactions were performed using a 10 min hold at 95°C, then 95°C for 15 s and at 60°C for 1 min repeated for 40 cycles using RealTime PCR System (Applied Biosystems, Carlsbad, CA). The primer sequences used were NCBI Reference Sequence: NM_021624.3 (H4R), NCBI Reference Sequence: NM_007232.2 (H3R), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Expression of target genes was normalized to that of GAPDH and the mean value set to 1.0. The PCR reaction was run on a 1% agarose gel with SYBR green (Invitrogen, Waltham, MA) and visualized under UVI Safe HD2, transilluminator (UVITECH Limited, Cambridge, UK).
Adderley S.P., Zhang X.E, & Breslin J.W. (2015). Involvement of the H1 histamine receptor, p38 MAP kinase, MLCK, and Rho/ROCK in histamine-induced endothelial barrier dysfunction. Microcirculation (New York, N.Y. : 1994), 22(4), 237-248.
+ Open protocol
+ Expand
4

Quantifying Antibiotic Resistance Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA and RNA of the sorted cells were isolated using a commercial extraction kit (Qiagen bacteria; DNA minikit for DNA isolation and Ambion PureLink RNA minikit for RNA isolation). The relative copy number of the plasmid in each sample was determined by comparing the threshold cycle (CT) value of the CTX-M-14 gene to that of the chromosomal gene gapA using quantitative real-time PCR. All amplifications were performed on an RT-Cycler amplifier (Capitalbio, China) with SYBR green (SYBR Premix Ex and TaqTM II; Takara). The relative mRNA of CTX-M-14 was determined using real-time PCR after being reverse transcribed to cDNA (PrimeScript RT reagent kit; Takara). Primers were as follows: for CTX-M-14, F, 5′ GGC TCA AAG GCA ATA CGA 3′; R, 5′ TTA TCA CCC ACA GTC CAC GA 3′; for gapA, F, 5′ ACT TCG ACA AAT ATG CTG GC 3′; R, 5′ CGG GAT GAT GTT CTG GGA A 3′.
Wang X., Kang Y., Luo C., Zhao T., Liu L., Jiang X., Fu R., An S., Chen J., Jiang N., Ren L., Wang Q., Baillie J.K., Gao Z, & Yu J. (2014). Heteroresistance at the Single-Cell Level: Adapting to Antibiotic Stress through a Population-Based Strategy and Growth-Controlled Interphenotypic Coordination. mBio, 5(1), e00942-13.
+ Open protocol
+ Expand
5

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA collected using an RNA mini kit (Ambion, Carlsbad, CA, USA) was reverse-transcribed to complementary DNA using the SuperScript III First-Strand Synthesis Systems kit (Invitrogen, Carlsbad, CA, USA). A real-time PCR System 7500 (Applied Biosystems, Foster City, CA, USA) was used to measure mRNA expression using primers and probes for glyceraldehyde-3-phosphate dehydrogenase (GAPDH, Hs99999905_m1) as an endogenous control, TNF-α (Hs01113624_g1), IL-6 (Hs00985639_m1), IL-8 (Hs00174103_m1), osteocalcin (Hs01587814_g1), ALP (Hs01029144_m1), and type I collagen (Hs00164004_m1). mRNA expression was examined using specific primers for IL-1β (forward, 5'-TCATTGCTCAAGTGTCTGAAGC-3'; reverse, 5'-TGGTCGGAGATTCGTAGC-3'), IL-8 (forward, 5'-ACTGAGAGTGATTGAGAGTGGAC-3'; reverse, 5'-AACCCTCTGCACCCAGTTTTC-3'), IL-6 (forward, 5'-GAA AGCAGCAAAGAGGCACT-3'; reverse, 5'-TTTCACCAGGCAAGTCTCCT-3'), stathmin (forward, 5'-ACTGCCTGTCGCTTGTCT; reverse, 5'-GTCTCGTCAGCAGGGTCT-3'), spondin-2 (forward, 5'-CGGCCAAATACAGCATCACC-3'; reverse, 5'-CCCAGCAGCGAAGACCACT-3'), layilin (forward, 5'-AGGAGTAAGGAGTCTGGATGGGTG-3'; reverse, 5'-GGATGACTGGCTGGGATAAAGGA-3'), TGF-β1 (forward, 5'-GGACACCAACTATTGCTTCAG-3'; reverse, 5'-TCCAGGCTCCAAATGTAGG-3'), TGF-β2 (forward, 5'-GGCTCAGTGGGCAGCTTGT-3'; reverse, 5'-GCTCAATCCGTTGTTCAGGC-3'), and GAPDH (forward, 5'-AGCCGCATCTTCTTTTGCGTC-3'; reverse, 5'-TCATATTTGGCAGGTTTTTCT-3').
Um S., Lee J.H, & Seo B.M. (2018). TGF-β2 downregulates osteogenesis under inflammatory conditions in dental follicle stem cells. International Journal of Oral Science, 10(3), 29.
+ Open protocol
+ Expand
6

Mechanical Loading of 3D Cell Cultures

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
After 14 days of culture, the 3D-constructed tissue was cyclically compressed by pressurizing the culture chamber. The chamber was pressurized by sealing the outlet tubing with an artery clamp (Fig. 2B). The syringe pump was programmed to cyclically feed and withdraw the culture medium at a rate of 0.5 mL/min at a frequency of 0.17 Hz as shown in Fig. 2C. The cells were loaded for 10 min per day for 2 days. This flow rate and frequency were chosen based on: (1) the adhesive strength of the device; higher flow rates damaged the device, and (2) the limited resolution of the syringe pump; 0.17 Hz was the highest possible frequency achievable. Similar frequency and loading duration were previously used by other in vitro studies to observe the response of bone cells to mechanical loading.30 ,38 For control 3D culture, the flow rate was programmed to fluctuate, but the medium outlet was not closed off so that the tissue samples did not undergo pressurization/depressurization cycles. The 3D samples were harvested immediately after the 10-min loading on the second day. RNA was extracted using a RNA Mini kit (Ambion) directly after the treatment using the procedures described previously.35 (link) For histology, 3D samples were harvested 24 h after the treatment and fixed with 4% paraformaldehyde (PFA, Affymetrix).
Sun Q., Choudhary S., Mannion C., Kissin Y., Zilberberg J, & Lee W.Y. (2017). Ex Vivo Replication of Phenotypic Functions of Osteocytes through Biomimetic 3D Bone Tissue Construction. Bone, 106, 148-155.
+ Open protocol
+ Expand
7

Macrophage Cytokine Response to Glycoprotein

Check if the same lab product or an alternative is used in the 5 most similar protocols
J774 macrophage cell lines (105cells/well) were cultured in Dulbecco's Modified Eagle Medium (DMEM, ThermoFisher Scientific), 1% antibiotic (penicillin-streptomycin; 10,000 U/mL) (ThermoFisher Scientific), 25 mM Hepes and 10% fetal bovine serum (FBS) in 12-well cell culture plates (ThermoFisher Scientific). Cells were treated with 100 µM butyric acid or distilled H2O (control) for 10 min before addition of 50 µg recombinant membrane glycoprotein at 37°C, 5% CO2 for 12 h. In some experiments, cells were treated with 50 µg recombinant GFP or membraneglycoprotein. Three wells for each treatment were conducted. After centrifugation at 4,000 g for 5 min, the level of IL-6 in supernatants was quantified by ELISA. Cell pellets were extracted with a RNA mini kit (Ambion, Carlsbad, CA, USA). The gene expression of the PDE4B was quantified by RT PCR.
Pham M.T., Yang A.J., Kao M.S., Gankhuyag U., Zayabaatar E., Jin S.L, & Huang C.M. (2021). Gut probiotic Lactobacillus rhamnosus attenuates PDE4B-mediated interleukin-6 induced by SARS-CoV-2 membrane glycoprotein. The Journal of Nutritional Biochemistry, 98, 108821.
+ Open protocol
+ Expand
8

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from tissues using RNA mini kit (Ambion) and 4 μg was reverse-transcribed with moloney-murine leukaemia virus (M-MLV) reverse transcriptase (ELPIS biotech). qRT-PCR was performed on Applied Biosystems StepOne with SYBR Green real-time PCR master mix (Applied Biosystems) according to the manufacture’s protocol. Actin was used as an internal control. Each sample was examined in triplicate. The relative expression levels of mRNA were determined by normalizing with internal controls and calculated by using the comparative Ct method. The following primer sequences were used: Crif1 (5′-GCGAAAGCAGAAGCGAGAAC-3′, 5′-GGCCCTCCGCTCCTTGT-3′), Axin2 (CCCTCCGGCAGCTATGAA, GGAGAGGTGGTCGTCCAAAA), Lef1 (5′-AGGGCGACTTAGCCGACAT-3′, 5′-TGCTGGCTGGGATGATTTC-3′), Actin (5′-CGATGCCCTGAGGCTCTTT-3′, 5′-TGGATGCCACAGGATTCCA-3′).
Shin J.M., Choi D.K., Sohn K.C., Kim J.Y., Im M., Lee Y., Seo Y.J., Shong M., Lee J.H, & Kim C.D. (2017). Targeted deletion of Crif1 in mouse epidermis impairs skin homeostasis and hair morphogenesis. Scientific Reports, 7, 44828.
+ Open protocol
+ Expand
9

PTH treatment in 2D and 3D cultures

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
After 14 days of perfusion culture, the 3D and 2D culture samples were treated with human PTH (1–34) (TOCRIS) at 50 nM in the osteogenic medium for 48 h. RNA was extracted using a RNA Mini kit (Ambion) directly after the treatment using the procedures described previously.35 (link) Also, the effluent culture medium was collected over a period of 24 h after the treatment. The 3D tissue samples were collected 24 h after the treatment and fixed with 4% PFA for histology.
Sun Q., Choudhary S., Mannion C., Kissin Y., Zilberberg J, & Lee W.Y. (2017). Ex Vivo Replication of Phenotypic Functions of Osteocytes through Biomimetic 3D Bone Tissue Construction. Bone, 106, 148-155.
+ Open protocol
+ Expand
10

Transcriptional Analysis of ΔVdPbs2 Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fresh mycelium of ΔVdPbs2 mutants and wild type were cultured in CM at 25°C for 5 days and collected with single-layer miracloth. Mycelia were subjected to RNA extraction using TRIzol reagent (Invitrogen) and purified with the RNA Mini Kit (Ambion). RNA integrity was confirmed by agarose gel electrophoresis. Reverse-transcription PCR was performed with Oligo-DT and SuperScript III reverse transcriptase (Invitrogen). Quantitative real-time PCR (qRT-PCR) was performed with SuperReal Premix Plus (TIANGEN, China) on an ABI 7500 real-time PCR system (Applied Biosystems, USA). The β-tubulin of V. dahliae is used as an internal reference. Relative expression levels were calculated using the ΔΔCT method (Livak and Schmittgen, 2001 (link)). All primers used in this study are listed in Supplementary Table S1.
Tian L., Wang Y., Yu J., Xiong D., Zhao H, & Tian C. (2016). The Mitogen-Activated Protein Kinase Kinase VdPbs2 of Verticillium dahliae Regulates Microsclerotia Formation, Stress Response, and Plant Infection. Frontiers in Microbiology, 7, 1532.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!