RNA was harvested using the TRIzol reagent (Invitrogen), according to the manufacturer’s guidelines. The RNA was transcribed into cDNA by miscriptreverse transcription kit (Takara, Japan). The level of mRNA was quantified by q-PCR with the QuantiTect SYBR Green PCR kit (Takara, Japan). The reaction conditions were 95°C for 10 min, followed by 95°C for 15 s for 40 cycles, and 60°C for 60 s. Primers used for PCR were as follows: CUX1-forward: 5′-AGCCGAAACCATAGCTCTTGA-3′; CUX1-reverse: 5′-GCCCTTTCGAGGTCCGTCAT-3′; GAPDH-forward: 5′- TGCACCACCAACTGCTTAGC-3′; GAPDH-reverse: 5′-GGCA TGCACTGTGGTCATGAG-3′. The mRNA level of target genes was compared to GAPDH by qPCR using the comparative cycle threshold (2–ΔΔCT) method. All assays were independently performed in triplicate.
Miscript reverse transcription kit
Manufactured by Takara Bio
Sourced in Japan, China
The MiScript Reverse Transcription Kit is a laboratory tool designed for the reverse transcription of microRNA (miRNA) and other small RNA molecules into complementary DNA (cDNA). The kit provides the necessary reagents and protocols for this essential step in miRNA analysis and quantification workflows.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Takara Bio (4 mentions)
Sybr green pcr kit, by Takara Bio (3 mentions)
Abi 7500 sequencing detection system, by Thermo Fisher Scientific (3 mentions)
Quantitect sybr green pcr kit, by Takara Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Takara Bio (2 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
Gapdh, by Thermo Fisher Scientific (1 mentions)
Miscript sybr green pcr kit, by Takara Bio (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Taqman assay kit, by Thermo Fisher Scientific (1 mentions)
Quantitect sybr green rt pcr kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Merck Group (1 mentions)
Trizol kit, by Thermo Fisher Scientific (1 mentions)
Fluorescence quantitative pcr instrument, by Roche (1 mentions)
Sybr premix ex taqtm pcr kit, by Takara Bio (1 mentions)
Sybr green mix, by Takara Bio (1 mentions)
Abi 7500 system, by Thermo Fisher Scientific (1 mentions)
15 protocols using miscript reverse transcription kit
1
RNA Extraction and qPCR Analysis of CUX1 Expression
2
Quantifying TROAP mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was harvested using the Trizol reagent (Invitrogen), according to the manufacturer's guidelines. The RNA was transcribed into cDNA by miscriptreverse transcription kit (Takara). The level of mRNA was quantified by q‐PCR with the QuantiTect SYBR Green PCR kit (Takara). The following primers were used: TROAP forward: 5‐CCTCCGGGGTGTATCTCCTAC‐3; reverse: 5‐ACGGCGCACGATGTAACAG‐3; GAPDH forward: 5‐TGACTTCAACAGCGACACCCA‐3; reverse: 5‐CACCCTGTTGCTGTAGCCAAA‐3. The expression of TROAP mRNA was normalized to GAPDH mRNA.
3
Quantifying CircRNA, miRNA, and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in tissues and cells was extracted using the TRIzol method (Invitrogen, Carlsbad,
CA, USA). The extracted RNA was then reverse transcribed into complementary deoxyribose nucleic acid (cDNA) in strict accordance with miScript Reverse Transcription Kit (TaKaRa, Otsu,
Shiga, Japan). The expression levels of CirCHIPK3,miR‐193a and HMGB1 were detected via qRT‐PCR. Glyceraldehyde 3‐phosphate dehydrogenase (GADPH) and U6 were used as internal references. The relative expression levels of CirCHIPK3, miR‐193a and HMGB1 were calculated by the 2‐ΔΔCt method. The experiment was repeated three times in each group. Primer sequences used in this study were as follows: CirCHIPK3, forward: 5′‐TTCAACATATCTACAATCTCGGT‐3′, reverse: 5′ ACCATTCACATAGGTCCGT‐3′; miR‐193a, forward: 5′‐TGGGTCTTTGCGGGC‐3′, reverse: 5′‐GAATACCTCGGACCCTGC‐3′; U6: forward: 5′‐GCTTCGGCAGCACATATACTAAAAT‐3′, reverse: 5′‐CGCTTCAGAATTTGCGTGTCAT‐3′; GAPDH: forward: 5′‐CGCTCTCTGCTCCTCCTGTTC‐3′, reverse:5′‐ATCCGTTGACTCCGACCTTCAC‐3′. miR‐193a was normalized to U6 while CirCHIPK3 and HMGB1 was normalized to GAPDH.
CA, USA). The extracted RNA was then reverse transcribed into complementary deoxyribose nucleic acid (cDNA) in strict accordance with miScript Reverse Transcription Kit (TaKaRa, Otsu,
Shiga, Japan). The expression levels of CirCHIPK3,miR‐193a and HMGB1 were detected via qRT‐PCR. Glyceraldehyde 3‐phosphate dehydrogenase (GADPH) and U6 were used as internal references. The relative expression levels of CirCHIPK3, miR‐193a and HMGB1 were calculated by the 2‐ΔΔCt method. The experiment was repeated three times in each group. Primer sequences used in this study were as follows: CirCHIPK3, forward: 5′‐TTCAACATATCTACAATCTCGGT‐3′, reverse: 5′ ACCATTCACATAGGTCCGT‐3′; miR‐193a, forward: 5′‐TGGGTCTTTGCGGGC‐3′, reverse: 5′‐GAATACCTCGGACCCTGC‐3′; U6: forward: 5′‐GCTTCGGCAGCACATATACTAAAAT‐3′, reverse: 5′‐CGCTTCAGAATTTGCGTGTCAT‐3′; GAPDH: forward: 5′‐CGCTCTCTGCTCCTCCTGTTC‐3′, reverse:5′‐ATCCGTTGACTCCGACCTTCAC‐3′. miR‐193a was normalized to U6 while CirCHIPK3 and HMGB1 was normalized to GAPDH.
4
Total RNA Extraction and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by TRIzol reagent (Invitrogen, USA). Then, the concentration of total RNA was measured by ultraviolet spectrophotometer. RNA was reverse transcribed into cDNA in the miScript Reverse Transcription Kit (TaKaRa, Japan) according to the manufacturer’s instructions. Small RNA, U6, was used as a reference gene.
5
Analyzing miRNA and mRNA Expression in BMMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured BMMSCs and from femur bone tissues using Trizol (Invitrogen) according to the manufacturer's instructions. MiRNA was extracted with the mirVana miRNA Isolation Kit (Ambion, Austin, TX, USA). The conversion of miRNA and mRNA into cDNA and the detection of miRNAs were carried out according to the manufacturer's instructions using the miScript Reverse Transcription Kit and the miScript SYBR Green PCR Kit (Takara Bio Inc., Shiga, Japan), respectively. Sequences were determined with the CFX96 Real-Time System (Bio-Rad, CA, USA). The optimized miRNA-specific primers for has-miR-17 and the endogenous control U6 were commercially obtained (RiboBio Co., Guangzhou, China). Primary-miR-17 and GAPDH as endogenous control were commercially purchased (Invitrogen). The expression levels of p16, p21, p53, Runx2, ALP, Osterix, TCF3 and Smurf1 (Takara Bio Inc.) were examined. The primers were listed in Table 1 . Experiments were performed in triplicate.
6
Quantitative RT-PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using the TRIzol reagent (Takara Biotechnology), and the first‐strand cDNA was synthesized from RNA via the miScript Reverse Transcription Kit (Takara) according to the manufacturer's protocols. qRT‐PCR was carried out with the SYBR Green PCR kit (Takara Biotechnology), and sequence detection was performed using an ABI 7500 Sequencing Detection System (Applied Biosystems). β‐actin was used as the housekeeping gene. The primers used for expression analysis are listed in Table 1 .
7
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from CC tissue specimens and cell lines (CaSki and SiHa) using TRIzol reagent (Invitrogen). Complementary DNA (cDNA) was synthesized using the PrimeScript RT reagent kit (TaKaRa, Dalian, China). MiScript reverse transcription kit (TaKaRa) was used for the reverse transcription from RNAs to cDNA. SYBR-Green PCR Master Mix (TaKaRa) was applied for conducting the reaction. The internal control was normalized by U6 and GAPDH. The gene mRNA expression was analyzed using 2−ΔΔCt methods. The primers were shown in Supplemental Table1 .
8
Quantifying AK046177 and miR-134 in I/R and OGD/R
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of AK046177 and miR-134 were analyzed by real-time PCR in both brains and cell cultures after I/R or OGD/R. Total RNA was isolated from 30 mg cerebral cortical tissue or cells (1 × 106/ml) seeded on 6-well plates with TRIzol Reagent (Invitrogen) [29 (link)], and reverse transcribed into cDNA using miScript Reverse Transcription Kit (Takara, China). Predesigned PCR primer/probes of miR-134 were obtained from GenePharma (Shanghai, China) for AK046177 and miRNA-134, with β-actin and U6 small nuclear RNA (U6) used as an internal control. Quantitative PCR was conducted as previously described using the TaqMan Assay Kit (Applied Biosystems) [30 (link)]. The relative expression levels of AK046177 and miRNA-134 were calculated using the 2−ΔΔCT method [31 (link)].
9
Quantitative Analysis of PRMT5, IL-6, and IL-8 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the designated treatments with EPZ015666 or transfected with siRNA for 48 hrs and then treated with TNF‐α or IL‐1β for 12 hrs, total RNAs were extracted using TRIzol (Sigma‐Aldrich) and were reverse‐transcribed to cDNA using miScript Reverse Transcription Kit (TaKaRa Biomedical Technology, Kusatsu, Japan ). The mRNA expression of PRMT5, IL‐6 and IL‐8 was analysed by real‐time quantitative polymerase chain reaction (qPCR) which was performed on cDNA using QuantiTect SYBR Green RT‐PCR Kit on StepOnePlusTM Instantaneous analyse PCR System (Applied Biosystems, Foster City, CA, USA). The expression of relative mRNA was more normalized to the GAPDH. The used RT‐PCR primers were listed in Table S1.
10
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using TRIzol reagent (Takara Biotechnology, Japan), and cDNA was synthesized from RNA with the miScript Reverse Transcription Kit (Takara, Tokyo, Japan) according to the manufacturer’s protocols. qRT-PCR was carried out with the SYBR Green PCR kit (Takara Biotechnology, Japan) and sequence detection was performed using an ABI 7500 Sequencing Detection System (Applied Biosystems, Foster City, CA). β-actin was used as the housekeeping gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!