cDNA of OsDGD2β was PCR amplified (Primer: D2b-cD-F/−R) using KOD Neo plus polymerase (TOYOBO) and initially inserted into pMD18-T vector for sequence confirmation. Primer pair D2b-HR-F/−R was used for PCR amplification of the cDNA (with sequence overlapped) from the recombinant vector and inserted into pGFP-EGFP via XhoI and NcoI restriction sites using the homologous recombination method (Vazyme Biotech co., Ltd), resulting in an C-terminal fusion with GFP, i.e. 35S:OsDGD2β:GFP. The protoplast was extracted from 10 days old rice seedlings and the construct was transfected into the extracted protoplasts using polyethylene glycol (He et al. 2016 (link)), incubated for 14 h and observed under a confocal scanning microscope (LSM780, Zeiss, Germany).
Kod plus neo polymerase
Manufactured by Toyobo
Sourced in Japan, China
The KOD-Plus-Neo polymerase is a high-fidelity DNA polymerase derived from the Thermococcus kodakarensis (KOD) thermophilic archaea. It exhibits exceptional processivity and proofreading ability, resulting in a low error rate during DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
In fusion hd cloning kit, by Takara Bio (7 mentions)
Rneasy plant mini kit, by Qiagen (4 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Lsm 780, by Zeiss (2 mentions)
Micropulser, by Bio-Rad (2 mentions)
Abi 3730 instrument, by Thermo Fisher Scientific (2 mentions)
Doxycycline, by Takara Bio (2 mentions)
Pgem t, by Addgene (2 mentions)
Psbtet gp vector, by Addgene (2 mentions)
Pcmv cat t7 sb100x, by Addgene (2 mentions)
Pgem t, by Promega (2 mentions)
Puromycin, by Merck Group (2 mentions)
Abi 3130 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Restriction enzyme, by Takara Bio (1 mentions)
Beechwood xylan, by Merck Group (1 mentions)
Ppic9, by Thermo Fisher Scientific (1 mentions)
Total rna isolation system kit, by Promega (1 mentions)
Pichia pastoris gs115, by Thermo Fisher Scientific (1 mentions)
T4 dna ligase, by Promega (1 mentions)
L rhamnose, by Merck Group (1 mentions)
52 protocols using kod plus neo polymerase
1
Subcellular Localization of OsDGD2β
2
Subcellular Localization of OsMGD2 in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA of OsMGD2 was PCR-amplified (Primer: M2-cD-F/-R) using KOD Neo plus polymerase (TOYOBO, Japan) and initially inserted into pMD18-T vector for sequence confirmation. The cDNA was further PCR amplified from the recombinant pMD18-T-vector using primer pair M2-HR-F/-R and inserted into the pGFP-EGFP vector via XhoI and NcoI restriction sites using the homologous recombination method (Vazyme Biotech co., Ltd.). Protoplasts were extracted from 10 days old rice seedlings and the recombinant pGFP-EGFP construct with OsMGD2 cDNA was transfected into the extracted protoplasts using polyethylene glycol (He et al., 2016 (link)), incubated for 14 h. Rice protoplasts were imaged at room temperature using a LSM780 inverted confocal microscope with an Argon laser (Germany). GFP was excited at 488 nm, and the emitted light was captured at 500–550 nm. Chlorophyll autofluorescence was excited at 488 nm, and the emitted light was captured at 650–750 nm.
3
Saturation Mutagenesis for Thermostability
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S3 was subject to saturated mutation. After thermostability screening in 96-well microplates, the mutant with greatest thermostability was selected for the second saturation mutation at D35. Mutants harboring different mutation sites were generated using overlap PCR with KOD neo Plus polymerase (TOYOBO, Osaka, Japan) and specific primers (Supplementary Table 2 ). The PCR products were sequenced for verification. Heterologous expression and characterization of mutant enzymes were conducted as described for the wild-type. And the correct mutants were further confirmed by PCR amplification with the AOX primers.
4
Heterologous Expression of Xylanase from Bispora
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bispora sp. MEY-1 CGMCC 2500 from the China General Microbiological Culture Collection Center (Beijing, China) was grown in PDB medium at 30°C. Escherichia coli Trans1-T1 (Tiangen, Beijing, China) was used for gene cloning and sequencing. Vector pPIC9 and Pichia pastoris GS115 from Invitrogen (Carlsbad, CA) were used for heterologous expression. Beechwood xylan was purchased from Sigma-Aldrich (St. Louis, MO). The DNA purification kit from OMEGA (Norcross, GA), KOD neo Plus polymerase from TOYOBO (Osaka, Japan), restriction enzymes from TaKaRa (Otsu, Japan), and total RNA isolation system kit and T4 DNA ligase from Promega (Madison, WI) were purchased. All chemicals were of analytical grade and commercially available.
5
Production of (-)-alpha-Bisabolol in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The E. coli DH5α bacterial strains were used for cloning and plasmid maintenance. The E. coli strains DH5α and WM335 were used for (−)-α-bisabolol production. Lysogeny broth (LB) medium (containing 10 g/l tryptone, 5 g/l yeast extract, and 10 g/l sodium chloride) was used for all experiments except those with specific indications. MOPS EZ Rich Defined (EZ) medium (Teknova, Hollister, CA, USA) was used per the manufacturer's protocol without ACGU solution. To produce (−)-α-bisabolol, terrific broth containing glycerol (TBG) medium (containing 12 g/l enzymatic casein digest, 24 g/l yeast extract, 9.4 g/l K2HPO4, 2.2 g/l KH2PO4, and 3.5% (w/v) glycerol) was used. SOC medium (containing 20 g/l tryptone, 5 g/l yeast extract, 0.5 g/l sodium chloride, 2.4 g/l magnesium sulfate, 186 mg/l potassium chloride and 4 g/l glucose) was used as a recovery medium after the transformations. l -Rhamnose and antibiotics were purchased from Sigma-Aldrich (St. Louis, MO, USA). Ampicillin was used at a concentration of 100 μg/ml; chloramphenicol at 34 μg/ml; and kanamycin at 25 μg/ml, unless specified otherwise. For the polymerase chain reaction, high fidelity KOD-Plus-Neo polymerase (Toyobo, Osaka, Japan) was used with the standard protocol. All restriction and modification enzymes were purchased from New England BioLabs (NEB, Ipswich, MA, USA).
6
Transient overexpression of olNbs1-Venus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence of olNbs1 was amplified from first strand complementary DNA of Hd-rR embryos by using KOD-plus- polymerase (TOYOBO, Osaka, Japan) and primers designed based on the Hd-rR sequence of olNbs1 (NBS_shinF_xho1, CCGCTCGAGCCCGCTGTTTACATTTCTCG , NBS_shinR_linkerXho1, CCGCTCGAGACCTCCACCTCCCCTGAAC ). The olNbs1 sequence was then subcloned into XhoI site of pG-olphsp70.1-hRluc-Venus, which enables transient and induced overexpression of olNbs1-Venus protein by heat induction at 41°C for 2 h [43 (link)]. To generate Q170H nonsynonymous mutation (CAG to CAT) the following primers were used, F.olNbs1_Q170H (CAACAGTGCTGTCCATCAAAAACGTCCGCC ), and R.olNbs1_Q170H (GGCGGACGTTTTTGATGGACAGCACTGTTG ). Overlapping PCR was conducted with KOD-plus-neo polymerase (TOYOBO), followed by digestion of the wild-type plasmid with DpnI. Then, the amplicon was introduced into an XL10-Gold competent cell (Stratagene, Agilent Technologies, Santan Clara, CA, USA). The plasmid was verified by sequencing.
7
Safflower Transcriptome Profiling via RACE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with the RNeasy Plant Mini Kit (Qiagen, Germany) according to the manufacturer’s protocol. The 3′- and 5′- cDNA libraries of safflower were constructed using the Clontech SmartTM Rapid Amplification of cDNA Ends (RACE) cDNA amplification kit (Clontech, USA). Then, RACE was carried out. Based on the sequences of the 3′- and 5′-RACE products, the primer were designed to clone the full length of genes. Polymerase chain reaction (PCR) was performed using cDNA (TransScript® One-Step gDNA Removal and cDNA Synthesis Super Mix; TransGen Biotech, Beijing, China) as a template and with KOD-Plus-Neo polymerase (Toyobo, Japan) under the following conditions: 30 cycles of 10 s denaturation at 94°C, 30 s annealing at 58°C, and 1 min amplification at 72°C. The PCR products were gel-purified (QIAquick® Gel Extraction Kit; Qiagen) and cloned into the PMD19T vector (TaKaRa, Japan). Using blue-white spot screening, the recombinant plasmids were recovered from Escherichia coli DH5α cells using QIAquick® Spin Plasmid Mini-prep kit (Qiagen) and both strands were sequenced (MeiJi, China).
8
Genomic DNA Extraction and 16S Sequencing of Zymomonas mobilis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNAs (gDNAs) of Z. mobilis extraction were performed by a Bacterial DNA Kit (Omega Biotek, USA). The quality of gDNAs was detected by Qubit 3 Fluorometer (ThermoFisher, USA), and then checked by gel electrophoresis (0.7% agarose, 120 V/cm, 50 min). PCR amplification of bacterial 16S rRNA gene was performed with general primer set 15F (AGAGTTTGATCCTGGCTCAG)/1492R (TACGGYTACCTTGTTACGACTT) and KOD-Plus-Neo polymerase (TOYOBO, Japan), using a thermal cycler with the following conditions: 95 °C for 5 min, 30 cycles of 98 °C for 10 s, 60 °C for 30 s, and 68 °C for 1 min.
The genome of mutant strains was sequenced using an Illumina HiSeq instrument (Illumina, San Diego, CA, USA). After the removal of adaptors, PCR primers, the content of N bases > 10%, and bases of quality lower than 20, clean data to the reference genome of strain ZM4 (GenBank No. NC_006526.2) was mapped. Annotation for potential SNVs were performed by Annovar (V21 Feb 2013). The sequencing was completed by GenWize Inc. (Suzhou, China).
The genome of mutant strains was sequenced using an Illumina HiSeq instrument (Illumina, San Diego, CA, USA). After the removal of adaptors, PCR primers, the content of N bases > 10%, and bases of quality lower than 20, clean data to the reference genome of strain ZM4 (GenBank No. NC_006526.2) was mapped. Annotation for potential SNVs were performed by Annovar (V21 Feb 2013). The sequencing was completed by GenWize Inc. (Suzhou, China).
9
Knock Out of Slco1b2 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The oligos (60 bp, containing Slco1b2 knock out target-site) and all primers for PCR/Q-PCR were synthesized by Biosune Biotechnology Co., Ltd. (Shanghai, China). KOD-plus-Neo polymerase was purchased from Toyobo (Osaka, Japan). SYBR Premix Ex Taq and Prime Script RT Reagent Kit were bought from Takara (Dalian, China). T7 endonuclease I (T7E I) was purchased from New England Biolabs (Ipswich, MA, USA). Phenol:chloroform:isoamyl alcohol (25:24:1, v/v/v) was purchased from Amresco (Cleveland, OH, USA). Bicinchoninic acid kit was purchased from Thermo Scientific (Waltham, MA, USA). The agarose gel recovery kit was bought from Generay Biotech Co., Ltd. (Shanghai, China). A primary antibody for OATP1B2 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was purchased from Abcam (Cambridge, UK). The fluorescence-conjugated secondary antibody to rabbit IgG and mouse IgG were bought from Cell Signaling Technology (Boston, MA, USA). Pitavastatin was obtained from MedChemExpress (Monmouth Junction, NJ, USA).
10
Amplification and Sequencing of Waxy Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Seven fragments of the Waxy gene were amplified from the extracted genomic DNA using the primer sets (Table 1 ). The PCR was performed in a 20 µL reaction mixture containing ~100 ng genomic DNA, 0.1 µM of each primer, 200 µM dNTP, 1.5 mM MgSO4, 1× PCR buffer, and 1 unit of KOD -Plus- neo polymerase (TOYOBO Co., Ltd., Osaka, Japan). PCR with primer sets (Hv_waxy_5F/Hv_waxy_5R and Hv_waxy_6F/Hv_waxy_6R) was performed in a three-step cycle (pre-incubation at 98 °C for 2 min, followed by 35 cycles of 98 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, and a final extension at 72 °C for 1 min. Step-down thermal cycling consisted of a pre-incubation at 94 °C for 2 min, 5 cycles of 98 °C for 10 s and 74 °C for 1 min, 5 cycles of 98 °C for 10 s and 72 °C for 1 min, 5 cycles of 98 °C for 10 s and 70 °C for 1min, 20 cycles of 98 °C for 10 s and 68 °C for 1 min, and a final extension at 68 °C for 7 min was performed using primer sets (Hv_waxy_1F-2/Hv_waxy_1R-2, Hv_waxy_2F/Hv_waxy_2R-2, Hv_waxy_3F/Hv_waxy_3R, Hor_wx_4F/Hor_wx_4R and Hv_waxy_7F-2/Hv_waxy_7R). After electrophoresis on an agarose gel, the bands of each gene fragment were cut out, and the gene fragments were extracted using a gel extraction kit (FastGene Gel/PCR Extraction Kit, Nippon Genetics Co., Ltd., Tokyo, Japan). Sanger sequence was performed using the primers (Table 1 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!