G50 column

Electrophoretic mobility shift assay was performed as described previously (Qin et al., 2014). Briefly, nuclear extracts prepared using Nuclear and Cytoplasmic Extraction reagents (Pierce, Rockford. IL, USA). Double‐stranded oligodeoxynucleotides containing the Smad binding element (SBE) (5'‐TCGAGAGCCAGACAAGGAGCCAGACAAGGAGCC‐AGACAC‐3' and its complementary strand) were used as probe. All oligonucleotides were synthesized from Invitrogen (Grand Island, NY, USA). The probe was 5'‐end‐labeled with [γ‐³²P]ATP using T4 polynucleotide kinase (Life Technologies Inc., Grand Island, NY, USA). The end‐labeled probe was purified with a G50 column (Roche Molecular Biochemicals, Indianapolis, IN, USA). Approximately 2 × 10⁵ cpm of end‐labeled DNA probe was incubated with 5 μg of nuclear extract on ice for 30 min. Protein‐DNA complexes were electrophoresed on 4% polyacrylamide gel at 30 mA for 100 min in TBE running buffer (1.0 m Tris, 0.9 m boric acid, 0.01 m EDTA). The gel was transferred to Whatman paper, vacuum‐dried, and scanned by STORM PhosphorImager.

EMSA was performed as described previously (Quan et al., 2001 (link)). Briefly, nuclear extracts were prepared using Nuclear and Cytoplasmic Extraction reagents (Pierce, Rockford. IL, USA). Double-stranded oligodeoxynucleotides containing the AP-1 binding site in the MMP-1 promoter (5′-ATAAAGCATGAGTCAGACAGCTC-3′) were used as probe. The AP-1 binding site is in bold font. All oligonucleotides were synthesized from Invitrogen (Grand Island, NY, USA). The probe was 5′-end-labeled with [γ-32p]ATP (New England Nuclear Life Science Products, Boston, MA, USA), and the end-labeled probe was purified with a G50 column (Roche Molecular Biochemicals, Indianapolis, IN, USA). Approximately 2 × 10⁵ cpm of end-labeled DNA probe was incubated with 5 μg of nuclear extract on ice for 30 min. Protein–DNA complexes were electrophoresed on 4% polyacrylamide gel at 30 mA for 100 min in TBE running buffer (1.0 m Tris, 0.9 m boric acid, 0.01 m EDTA). The gel was transferred to Whatman paper, vacuum-dried, and scanned by a STORM PhosphorImager.