Log In Sign up
The largest database of trusted experimental protocols

Antisense morpholino oligonucleotides mos

Manufactured by Gene Tools
Visit Supplier
Sourced in United States

Antisense morpholino oligonucleotides (MOs) are synthetic molecules that bind to and block the translation or splicing of target mRNA sequences. MOs are used in research to study gene function and knockdown gene expression.

Automatically generated - may contain errors

Lab products found in correlation

Sys micro4 controller, by World Precision Instruments (1 mentions) Nanoliter 2000 injector, by World Precision Instruments (1 mentions) Mmessage mmachine kit, by Thermo Fisher Scientific (1 mentions) Fluoview fv1000 mpe multiphoton confocal microscope, by Olympus (1 mentions) Carboxyfluorescein, by Gene Tools (1 mentions) Ix70 fla inverted fluorescence microscope, by Olympus (1 mentions) Szx16 stereomicroscope, by Olympus (1 mentions) Im 300 microinjector, by Narishige (1 mentions) Dissection stereomicroscope, by Leica camera (1 mentions) Pronase e, by Merck Group (1 mentions)

19 protocols using antisense morpholino oligonucleotides mos

1

Zebrafish Embryonic Development Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
The antisense morpholino oligonucleotides (MOs) were synthesized by Gene Tools, LLC. The sequences for MOs were as follows: ephb4b-MO1, 5′-GATCACTTCAGTCTCTCTGATATGA-3′; ephb4b-MO2, 5′-AATCCAGCAAACACGATCCATCTCA-3′; ephb4b-sMO, 5′-TCATCTCCTCCCACTGACACAACAC-3′; efnb2b-MO1, 5′-CGCAGGCACTAAAACGAGCACAATC-3′; efnb2b-MO2, 5′-TAACTCCAGACAGTCGCATCCATTG-3′; cMO, 5′-CCTCTTACCTCAGTTACAATTTATA-3′; ephb3a-MO, 5′-GACAGAAAGTCTCGTTAAATCTCAG-3′; efnb2a-MO, 5′-CGGTCAAATTCCGTTTCGCGGGA-3′ (Cooke et al., 2005 (link)).
For knockdown or overexpression in the whole embryo, reagents were injected at the one-cell stage. For knockdown or overexpression specifically in DFCs, reagents were injected together with 1 µg/µl Rhodamine into the yolk cell at around the 512-cell stage, followed by selection of Rhodamine-positive embryos at 60%-70% ES.
Unless otherwise stated, the injection doses were as follows: 10 ng ephb4b-MO2, 7 ng efnb2b-MO2, 300 pg ephb4b or ephb4b-mCherry, 400 pg ephb4bΔCT-mCherry, 250 pg CAAX-mCherry, 250 pg s-efnb2a-mCherry, 250 pg s-efnb2b-mCherry, 250 pg efnb2a-mCherry, 250 pg efnb2b-mCherry, 25 pg rhoaV14, 300 pg rhoaN19 and 300 pg dnrock2a mRNA.
Zhang J., Jiang Z., Liu X, & Meng A. (2016). Eph/ephrin signaling maintains the boundary of dorsal forerunner cell cluster during morphogenesis of the zebrafish embryonic left-right organizer. Development (Cambridge, England), 143(14), 2603-2615.
+ Open protocol
+ Expand
2

Antisense Morpholinos for Zebrafish Gene Knockdown

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Antisense morpholino oligonucleotides (MOs) were obtained from Gene Tools, LLC (Philomath, OR, USA). MOs were solubilized in DNase/RNase-free water to generate 4 mM stock solutions, which were stored at 20 °C. Zebrafish embryos were injected at the 1-cell stage with 5 nL of diluted MO. Optimal dosage was determined by previously published doses and our own experience [53 (link)]. esr1 was targeted with 5′–catgtaaaacaggctggtcacCTTG–3′ (0.4 mM). Esr2a was targeted with 5′–agagagtcttacCTTGTATACTC–3′ (0.8 mM). Esr2b was targeted with 5′–ttgaccatgagcattacCTTGAATG–3′ (0.8 mM) [53 (link)]. Uab127 embryos were genotyped with the forward primer 5′–GTCCCGCTTAGTCCCACAAT–3′ and the reverse primer 5′–TGACAGCTGCCACCTAAAGA–3′ [54 (link)].
Wesselman H.M., Gatz A.E., Pfaff M.R., Arceri L, & Wingert R.A. (2023). Estrogen Signaling Influences Nephron Segmentation of the Zebrafish Embryonic Kidney. Cells, 12(4), 666.
+ Open protocol
+ Expand
3

Zebrafish Molecular Genetics Protocol

Cited 6 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The ppargc1asa13186 line (ppargc1asa13186/sa13186) was obtained from ZIRC (Eugene, OR) (Busch-Nentwich et al., 2013 ). Homozygous mutant and heterozygous zebrafish were identified as previously described (Chambers et al., 2018 (link)) using genotyping primers, forward 5′–GGGCCGGCATGTGGAATGTAAAGACTTAAACATGCCAACCTCCACTACTACGACATCATCGTTGTCTTCCACCCCCCC TTCGTCTTCCTCACTGGCCAGG–3′, and reverse 5′–TCCCACTACCCCGCTATAGAAGGCTTGCTGAGGCTTTCCAAAGTGCTTGTTGAGCTCGTCCCGGATCTCCTGGTCCCTAAGAAGTTTCCTGCCACCAGAA–3′. Antisense morpholino oligonucleotides (MOs) were obtained from Gene Tools, LLC (Philomath, OR). MOs were solubilized in DNase/RNase free water to generate 4 mM stock solutions which were stored at −20°C. Zebrafish embryos were injected at the 1-cell stage with 1–2 nL of diluted MO. ppargc1a was targeted with the following validated MO: 5′–CCTGATTACACCTGTCCCACGCCAT–3′ (400 μM optimal, 200 μM suboptimal) (Hanai et al., 2007 (link); Bertrand et al., 2007 (link), Chambers et al., 2018 (link)). ptgs1 was targeted with the following validated MO: 5′-TCAGCAAAAAGTTACACTCTCTCAT-3′ (400 μM optimal, 200 μM suboptimal) (Marra et al., 2019a (link); Poureetezadi et al., 2016 (link), North et al., 2007 (link)). The ift88 MO was 5′-AGCAGATGCAAAATGACTCACTGGG-3′ (100uM) (Vasilyev et al., 2009 (link); Gerlach and Wingert, 2014 (link)). Control MO was 5′-CCTCTTACCTCAGTTACAATTTATA-3′ (400uM) (Gene Tools, LLC).
Chambers J.M., Addiego A., Flores-Mireles A.L, & Wingert R.A. (2020). Ppargc1a Controls Ciliated Cell Development by Regulating Prostaglandin Biosynthesis. Cell reports, 33(6), 108370.
+ Open protocol
+ Expand
4

prdm12b Knockdown Using Morpholinos

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antisense morpholino oligonucleotides (MOs) were obtained from Gene Tools LLC. MO injections were performed into the yolk of 1-cell stage embryos using 1-2 ng of solution containing dilutions of 3 mM morpholino stock, distilled water and phenyl red. An MO with the sequence 5′-GCAGGCAACACTGAACCCATGATGA-3′ was used to target the prdm12b translation start site. This MO was reported previously [22 ] and our analyses in this manuscript demonstrate that the effects of MO-mediated prdm12b knockdown are indistinguishable from the effects of prdm12b germ line mutations.
Yildiz O., Downes G.B, & Sagerström C.G. (2019). Zebrafish prdm12b acts independently of nkx6.1 repression to promote eng1b expression in the neural tube p1 domain. Neural Development, 14, 5.
+ Open protocol
+ Expand
5

Zebrafish Molecular Genetics Protocol

Cited 6 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The ppargc1asa13186 line (ppargc1asa13186/sa13186) was obtained from ZIRC (Eugene, OR) (Busch-Nentwich et al., 2013 ). Homozygous mutant and heterozygous zebrafish were identified as previously described (Chambers et al., 2018 (link)) using genotyping primers, forward 5′–GGGCCGGCATGTGGAATGTAAAGACTTAAACATGCCAACCTCCACTACTACGACATCATCGTTGTCTTCCACCCCCCC TTCGTCTTCCTCACTGGCCAGG–3′, and reverse 5′–TCCCACTACCCCGCTATAGAAGGCTTGCTGAGGCTTTCCAAAGTGCTTGTTGAGCTCGTCCCGGATCTCCTGGTCCCTAAGAAGTTTCCTGCCACCAGAA–3′. Antisense morpholino oligonucleotides (MOs) were obtained from Gene Tools, LLC (Philomath, OR). MOs were solubilized in DNase/RNase free water to generate 4 mM stock solutions which were stored at −20°C. Zebrafish embryos were injected at the 1-cell stage with 1–2 nL of diluted MO. ppargc1a was targeted with the following validated MO: 5′–CCTGATTACACCTGTCCCACGCCAT–3′ (400 μM optimal, 200 μM suboptimal) (Hanai et al., 2007 (link); Bertrand et al., 2007 (link), Chambers et al., 2018 (link)). ptgs1 was targeted with the following validated MO: 5′-TCAGCAAAAAGTTACACTCTCTCAT-3′ (400 μM optimal, 200 μM suboptimal) (Marra et al., 2019a (link); Poureetezadi et al., 2016 (link), North et al., 2007 (link)). The ift88 MO was 5′-AGCAGATGCAAAATGACTCACTGGG-3′ (100uM) (Vasilyev et al., 2009 (link); Gerlach and Wingert, 2014 (link)). Control MO was 5′-CCTCTTACCTCAGTTACAATTTATA-3′ (400uM) (Gene Tools, LLC).
Chambers J.M., Addiego A., Flores-Mireles A.L, & Wingert R.A. (2020). Ppargc1a Controls Ciliated Cell Development by Regulating Prostaglandin Biosynthesis. Cell reports, 33(6), 108370.
+ Open protocol
+ Expand
6

Antisense Morpholino Targeting sar1b

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antisense morpholino oligonucleotides (MOs) (Gene Tools, Corvallis, OR) were designed to target the sar1b 5′UTR sequence (sar1b-MO): 5′-CAGTCCAACGGGGATCAATGAGGAA-3′. The sar1b-MO targets bp 41–65 of the sar1b 5′UTR, which is 45 bp upstream of the ATG site. This target site is unique to sar1b and is not present in sar1a. 1 nl was injected into 1–2 cell stage embryos at increasing doses (0.4 ng–3 ng) to determine optimal concentrations. To confirm morpholino-targeting efficiency, 60 pg of sar1b-eGFP mRNA (see Fig. 1J, K) was co-injected with 0.4 ng and 1 ng of sar1b-MO, and loss of eGFP expression was analyzed. All data presented in figures are at 0.4 ng, determined to be the optimal concentration. Control morpholino provided by manufacturer did not generate morphological changes.
Levic D.S., Minkel J., Wang W.D., Rybski W.M., Melville D.B, & Knapik E.W. (2015). Animal model of Sar1b deficiency presents lipid absorption deficits similar to Anderson Disease. Journal of molecular medicine (Berlin, Germany), 93(2), 165-176.
+ Open protocol
+ Expand
7

Zebrafish Hypoxia Signaling Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antisense morpholino oligonucleotides (MOs) were obtained from Gene Tools (Philomath, OR, USA). An MO targeted against the translation initiation region of zHIF-1α (zHIF-1α MO: 5′-CAG TGA CAA CTC CAG TAT CCA TTC C-3′) was used to knockdown the zHIF-1α protein. The standard control MO (5′-CCT CTT ACC TCA GTT ACA ATT TAT A-3′) was used as an injection control. The optimized morpholino amount for zHIF-1α knockdown experiments was 8 ng/embryo. Injected embryos were reared to the desired developmental stages under hypoxic or normoxic conditions as described above.
Tan T., Yu R.M., Wu R.S, & Kong R.Y. (2017). Overexpression and Knockdown of Hypoxia-Inducible Factor 1 Disrupt the Expression of Steroidogenic Enzyme Genes and Early Embryonic Development in Zebrafish. Gene Regulation and Systems Biology, 11, 1177625017713193.
+ Open protocol
+ Expand
8

Antisense Morpholino Oligonucleotides for miR-125 Family

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antisense morpholino oligonucleotides (MOs) were obtained from Gene Tools (Fig. S2 for morpholino coverage over each member of the miR-125 family). The following pre-miRNA processing, blocking and control morpholino were used; miR-125-MO targeted sequence: 5’ AAACGTCACAAGTTAGGGTCTCAGG 3′, Control MO scrambled sequence: 5’ CCTCTTACCTCAGTTACAATTTATA 3′. Antisense MO oligonucleotides were diluted in water to give a stock concentration of 8.3 μg/μl. Microinjections of 5–6 ng of the MO were performed at the 1–2 cell stage using a Nanoliter 2000 injector together with a Sys-Micro4 controller (World Precision Instruments).
Wade S.M., Ohnesorge N., McLoughlin H., Biniecka M., Carter S.P., Trenkman M., Cunningham C.C., McGarry T., Canavan M., Kennedy B.N., Veale D.J, & Fearon U. (2019). Dysregulated miR-125a promotes angiogenesis through enhanced glycolysis. EBioMedicine, 47, 402-413.
+ Open protocol
+ Expand
9

Antisense Morpholinos for rbc3a and atp6v0a1

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Antisense morpholino oligonucleotides (MOs) targeting the rbc3a 5′ untranslated region (rbc3a-MO1), translation start site (rbc3a-MO2), and the previously described atp6v0a1 intron/exon boundary (v0a1-MO [27] (link)) were purchased from Gene Tools and dissolved in 1× Danieau buffer for injection. For MO experiments, 1–3 ng of rbc3a-MO1/embryo, 5 ng of rbc3a-MO2/embryo, or 4 ng of v0a1-MO/embryo was injected into one- to four-cell-stage embryos along with 1 ng p53-MO/embryo to inhibit nonspecific cell death. Unless otherwise noted, all Rbc3a knockdown experiments were performed with rbc3a-MO1. See Table S2 for MO sequences. For RNA injection experiments, the full-length ORFs of rbc3a in Tol2CG or zebrafish frizzled7b-YFP (fz7-yfp) pCS2+ construct [32] (link) were translated using mMessage mMachine kit (Ambion) and injected at the one-cell stage. A pCMVSPORT6 DNA vector containing a shortened ORF of Xenopus rbc3a (Open Biosystems, Accession No. BC127555) was injected at the one-cell stage.
Tuttle A.M., Hoffman T.L, & Schilling T.F. (2014). Rabconnectin-3a Regulates Vesicle Endocytosis and Canonical Wnt Signaling in Zebrafish Neural Crest Migration. PLoS Biology, 12(5), e1001852.
+ Open protocol
+ Expand
10

Xenopus Embryo Manipulation Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Embryos of Xenopus laevis were obtained by artificial fertilisation. They were maintained in 10% normal amphibian medium (NAM) (100 mM NaCl, 2 mM KCl, 1 mM Ca(NO3)2.4H2O, 1 mM MgSO4.7H2O, 0.1mMEDTA, 0.02 mM NaH2PO4.2H2O, 0.08 mM Na2HPO4.2H2O) (Slack, 1984 (link)) at 20 °C and staged (Nieuwkoop and Faber, 1994 ). Xenopus embryos were injected at the one or two cell stage (as indicated in the figure legends) with antisense morpholino oligonucleotides (MOs) (dissolved in water) obtained from GeneTools, LLC or with sense RNA obtained by in vitro transcription (as indicated in the figure legends).
Collart C., Smith J.C, & Zegerman P. (2017). Chk1 Inhibition of the Replication Factor Drf1 Guarantees Cell-Cycle Elongation at the Xenopus laevis Mid-blastula Transition. Developmental Cell, 42(1), 82-96.e3.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!