RNA for QRT-PCR was isolated using the RNeasy Mini-kit (Qiagen). Cells were disrupted using a FastPrep bead beater (Bio101). RNA samples were rendered DNA free by incubation with Turbo-DNA free reagent (Ambion, Austin, TX). cDNA synthesis was carried out using the Superscript III First strand synthesis sytem for RT-PCR (Life technologies) as described by Moran et al. [19] (link) Reactions were carried on an ABI7500 Sequence Detector (Applied Biosystems, Foster City, CA) using MicroAmp Fast Optical 96-well Reaction plates (Applied Biosystems) in 20 µl reactions using 1X Fast SYBR Green PCR Master Mix (Applied Biosystems), 150 nM of each oligonucleotide (Table S4 ) and 2 µl of diluted template (10 ng). Cycling conditions used were 95°C for 20 sec, followed by 40 cycles of 95°C for 3 sec and 60°C for 30 sec, the latter of which was the point of detection of fluorescence. This was followed by a melt curve stage as a quality control point. Gene expression levels were normalized against the expression levels of the constitutively expressed ACT1 gene in the same cDNA sample. Gene specific primers are shown in Table S5 . Each gene-specific set was shown to amplify at a similar efficiency (within 10%) to the control ACT1 primer set in primer optimization experiments.
Abi 7500 sequence detector
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 7500 Sequence Detector is a real-time PCR instrument designed for quantitative and qualitative gene expression analysis. It features a 96-well block format and supports various fluorescent dye-based detection chemistries for gene expression, genotyping, and other applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (3 mentions)
Taqman gene expression assay kit, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq kit, by Takara Bio (2 mentions)
Magmax 96 total rna isolation kit, by Thermo Fisher Scientific (2 mentions)
Turbo dna free reagent, by Thermo Fisher Scientific (1 mentions)
Microamp fast optical 96 well reaction plate, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Rnalater, by Thermo Fisher Scientific (1 mentions)
Taqman universal master mix, by Thermo Fisher Scientific (1 mentions)
Taqman genotyping assay, by Thermo Fisher Scientific (1 mentions)
Dna blood mini kit, by Qiagen (1 mentions)
Sds 1, by Thermo Fisher Scientific (1 mentions)
Superscript 3 kit, by Thermo Fisher Scientific (1 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions)
25 protocols using abi 7500 sequence detector
1
Quantitative Real-Time PCR Protocol
2
Quantitative RT-PCR Analysis of Inflammatory Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated and transcribed to cDNA using a RevertAid™ First-Strand cDNA Synthesis Kit (Fermentas, Glen Burnie, MD, USA), according to the manufacturer’s protocol. Quantitative real-time PCR (qPCR) was performed on an ABI 7500 sequence detector (Applied Biosystems) using SYBR Green I and gene-specific primers (Table 2 ). Analysis by qPCR included the following steps: a hold step at 50 °C for 2 min to activate uracil-DNA glycosylase with a second hold step at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s followed by 60 °C for 1 min. Subsequently, melt analysis was performed by increasing the temperature from 65 to 95 °C. Target gene expression was normalized to GAPDH using the 2−∆∆CT method.
Related to materials and methods. Mouse primers for real-time PCR
| Gene name | Forward primer | Reverse primer |
|---|---|---|
| Mouse Tnf-α | CAGGAGGGAGAACAGAAACTCCA | CCTGGTTGGCTGCTTGCTT |
| Mouse Il-1β | TCCAGGATGAGGACATGAGCAC | GAACGTCACACACCAGCAGGTTA |
| Mouse iNOS | TAGGCAGAGATTGGAGGCCTTG | GGGTTGTTGCTGAACTTCCAGTC |
| Mouse Cox-2 | CAGGCTGAACTTCGAAACA | GCTCACGAGGCCACTGATACCTA |
| Mouse Il-6 | GCCAGAGTCCTTCAGAGAGA | GGTCTTGGTCCTTAGCCACT |
| Mouse Gapdh | TGTGTCCGTCGTGGATCTGA | AGGGGCCATCCACAGTCTTC |
3
Canine Lymph Node Biomarker Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lymph node biopsies were immediately placed in RNAlater (Ambion, Austin, TX) and stored at –80°C prior to RNA extraction. Total RNA extraction was performed using the RNeasy Mini Kit (Qiagen, Valencia, CA). Reverse transcription was performed using random hexamers and Superscript II reverse transcriptase (Invitrogen Corp., Carlsbad. CA, USA) according to the manufacturer's instructions. Primer sequences for canine A1, A20, Bcl-XL, c-FLIP, Cyclin D1, Bcl-2, XIAP and β-actin have been previously described [25] (link), [35] (link). Primers were synthesized by Invitrogen Corp. Real-time PCR assays were performed using SYBR Green (Fermentas, Glen Burnie, Maryland). Samples were run in triplicate using standard conditions on an ABI 7500 sequence detector (Applied Biosystems, Carlsbad, CA) and data were analyzed using β-actin as an endogenous control. Dissociation curves were performed after each experiment to confirm the specificity of product amplification. Statistical analysis was performed using a two-tailed Student's ‘t’ test where statistical significance = p<0.05.
4
Genetic Profiling of Vitamin D Metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from 200 μl peripheral blood leucocytes using the DNA Blood Mini Kit (Qiagen, Hilden, Germany). Allelic discrimination reactions were performed using approximately 20 ng of DNA and TaqMan Universal Master Mix (ThermoFisher) in 10-μl reactions. The TaqMan® genotyping assays used were all from ThermoFisher (Cat. No. 4351379) with product numbers C__2958431_10 for CYP2R1 rs20607939, C_29958084_10 for CYP24A1 rs6013897, C_26407519_10 for GC rs2282679, C_2404008_10 for VDR rs731236 (here referred to as Taq1), and C__12060045_20 for VDR rs2228570 (here referred to as Fok1). The PCR profile consisted of 95 °C for 10 min followed by 40 cycles of 92 °C for 15 s and 60 °C for 1 min. The fluorescence signal was measured with an ABI 7500 Sequence Detector (Applied Biosystems).
5
Quantitative PCR for CPE, Bcl-2, and Fgf2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplification was carried out with 100 nM (18S rRNA) or 300 nM (Bcl-2 or Fgf2) of forward and reverse primers, in a 12.5 µl volume, in an ABI 7500 Sequence Detector (Applied Biosystems). The cycling conditions were: 10 min denaturation at 95°C and 40 cycles of DNA synthesis at 95°C for 15 s and 60°C for 1 min. Primer sequences for rat CPE-ΔN fwd: 5′-CAAAAGAGACCAGCAGGAGGAC-3′ , rev: 5′-TCAGGTTCACCGGGCTCATG-3′ ; mouse CPE-ΔN fwd: 5′-GACAAAAGAGGCCAGCAAGA-3′ , rev: 5′-CAGGTTCACCCGGCTCAT-3′ ; rat Bcl2 fwd: 5′-AAGCTGTCACAGAGGGGCTA-3′ , rev:5′CAGGCTGGAAGGAGAAGATG-3′ ; rat FGF2 fwd: 5′- CACTTACCGGTCACGGAAAT-3′ , rev: 5′- CCGTTTTGGATCCGAGTTTA-3′ ; for 18S-fwd: 5′-CTCTTAGCTGAGTGTCCCGC-3′ , rev: 5′-CTGATCGTCTTCGAACCTCC-3′ . Fluorescence signals were analyzed using SDS 1.9.1 software (Applied Biosystems). 18S rRNA was used as the endogenous control for normalization. All qPCRs were performed in triplicates and were averaged to obtain the data point for each specimen. The relative amount of CPE mRNA was normalized to an internal control, 18S rRNA, given by Livak and Schmittgen [31] (link), 2−ΔΔCT, where ΔΔCT = [CT(CPE-ΔN)−CT(18S)]test−[CT(CPE-ΔN)−CT(18S)]. The threshold value (CT) was defined as the fractional cycle number at which the amount of amplified target reached a fixed threshold.
6
Quantifying Igf2r mRNA Expression in Splenic cDCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified splenic cDCs were treated with anti-mouse CD40 mAb (3/23, BD Biosciences) or ODN 1826 (Invivogen) for 4 h, and collected for RNA isolation via Purelink RNA mini kit (Invitrogen), and mRNA was converted to cDNA by SuperScript III kit (Invitrogen). Quantification of mRNA expression for Igf2r, normalized to glyceraldehyde-3-phosphate dehydrogenase levels (GAPDH), was performed on an ABI 7500 Sequence Detector (Applied Biosystems), using the following pairs of oligonucleotides. Igf2r: forward 5′-GTCATCAGCTTTGTGTGCCG-3′, reverse 5′-ACAGTACACTCCGTCGCTTG -3′; GAPDH: forward 5′-GTATGACTCCACTCACGGCAAAT-3′, reverse 5′- GTAGACTCCACGACATACTCAGCAC -3′. Relative mRNA level was calculated according to the 2-ΔΔCT method.
7
Comprehensive Biomarker Analysis in Chronic Hepatitis B
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The white blood cell and platelet (PLT) counts were determined from blood samples using an Automatic Blood Cell Counter Plus. Serum albumin, ALT, aspartate aminotransferase (AST), and TBil levels were measured with an Automatic Biochemical Analyzer. PT was examined using an Automatic Coagulometer from which the prothrombinase activity and the International normalized ratio (INR) were calculated. Automatic Architect assays were used to quantify the levels of HBsAg and HBeAg on an I2000 assay platform (Abbott Diagnostics, USA), with a lower limit of detection for HBsAg of 0.05 IU/mL and for HBeAg of 1.0 S/Co. Determination of the serum HBV DNA loads were carried out by real-time PCR on an ABI 7500 sequence detector (Applied Biosystems, USA). Serum IP-10, IFN-γ, IL-4, and TGF-β1 levels were determined by ELISA, according to the manufacturer’s instructions.
8
Quantifying miRNA and mRNA Expression in Osteosarcoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We verified the total mRNAs or miRNAs expression using qRT-PCR assays via the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) or the MIR Cut and Separation of miRNAs Kit (Tiangen, Beijing, China) from osteosarcoma tissues and cells. The first-strand cDNA was synthesized by Reverse Transcription System (Thermo Fisher Scientific, Waltham, MA, USA). MiRNAs Rapid Extraction Kit (BioTeke, Beijing, China) was employed to extract total miRNAs. RT-qPCR was performed using SYBR® Premix Ex Taq™ (TaKaRa, Dalian, China) in ABI7500 sequence detector (Applied Biosystems, Foster City, CA, USA). The relative expression of miR-19a and RhoB were calculated by 2−ΔΔCt method with U6 small nuclear RNA (U6) and glyceraldheyde 3-phosphate dehydrogenase (GAPDH) as the internal reference relatively. The cycling conditions for qPCR were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. Primers were as follows: miR-19a forward, 5ʹ-ACACTCCAGCTGGGTGTGCAAATCCATGCAA-3ʹ, reverse, 5ʹ-CTCACAGTACGTTGGTATCCTTGTGATGTTTCGATGCCATATTGTACTGTGAGTCAGTTTT-3ʹ; U6 forward, 5ʹ-GCTTCGGCAGCACATATACTAAAAT-3ʹ, reverse, 5ʹ-CGCTTCACGAATTTGCGTGTCAT-3ʹ; RhoB forward, 5ʹ-GCCTGTCCTAGAAGTGAA-3ʹ, reverse, 5ʹ-GAATGCTACTGTCGTATGC-3ʹ, GAPDH forward, 5ʹ-CTGGGCTACACTGAGCACC-3ʹ, reverse, 5ʹ-AAGTGGTCGTTGAGGGCAATG-3ʹ.
9
PLA2G7 Expression Quantification by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol (Invitrogen) was utilized to extract RNA from cells, after which a cDNA synthesis kit (Thermo Fisher Scientific, USA) was used based on provided directions to prepared cDNA. The expression levels were detected by QRT-PCR analysis with FastStart Universal SYBR-Green Master (Roche), an ABI7500 sequence detector (Applied Biosystems, Foster City, CA, USA) and calculated by 2 − ΔΔCt method. β-actin expression was used for normalization purposes, and primers used in this study were as follows: PLA2G7, Forward (F): 5′-GAACACACTGGCTTATGGGC-3′, Reverse (R): 5′-GAGATGCCAGGTCAATGCCA-3′.
10
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Invitrogen), as per the manufacturer's instructions. TaqMan reverse transcription reagents (Applied Biosystems) were used for the synthesis of complementary DNA from total RNA, as described [22] (link), [24] (link), [25] (link). Real-time quantitative PCR was performed using SYBR Green Universal Master Mix (Applied Biosystems) and an ABI 7500 sequence detector, along with the manufacturer's software (7000v1.3.1; Applied Biosystems), as previously described [24] (link). Relative quantities of mRNAs were calculated using the comparative threshold cycle method and normalized using human cyclophilin and mouse glyceraldehydes-3-phosphate dehydrogenase (GAPDH) as an endogenous control. The primers for human IL-8 and cyclophilin, as well as, mouse MIP-2 and GAPDH were previously described [16] (link), [24] (link). The primer sequences for human and mouse MKP-1 are as follows: human MKP-1: 5′-GCTGTGCAGCAAACAGTCGA-3′ and 5′-GCCACCCTGATCGTAGAGTG-3′ ; mouse MKP-1: 5′-GCTGTGCAGCAAACAGTCGA-3′ and 5′-CGATTAGTCCTCATAAGGTA-3′
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!